Incidental Mutation 'R6311:Cdh8'
ID509776
Institutional Source Beutler Lab
Gene Symbol Cdh8
Ensembl Gene ENSMUSG00000036510
Gene Namecadherin 8
Synonymscad8
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001039154.1, NM_007667.2; MGI:107434

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6311 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location99024471-99416471 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99400895 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 28 (Y28C)
Ref Sequence ENSEMBL: ENSMUSP00000114507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093249] [ENSMUST00000128860] [ENSMUST00000142129] [ENSMUST00000142475] [ENSMUST00000145601] [ENSMUST00000155527]
Predicted Effect probably damaging
Transcript: ENSMUST00000093249
AA Change: Y28C

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090935
Gene: ENSMUSG00000036510
AA Change: Y28C

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
CA 84 165 9.52e-17 SMART
CA 189 274 7.14e-30 SMART
CA 298 390 8.16e-16 SMART
CA 413 494 6.14e-20 SMART
CA 517 604 1.16e-11 SMART
transmembrane domain 622 644 N/A INTRINSIC
Pfam:Cadherin_C 645 712 1.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128860
AA Change: Y28C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117326
Gene: ENSMUSG00000036510
AA Change: Y28C

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
CA 84 165 9.52e-17 SMART
CA 189 274 7.14e-30 SMART
CA 298 390 8.16e-16 SMART
CA 413 494 6.14e-20 SMART
CA 517 604 1.16e-11 SMART
transmembrane domain 622 644 N/A INTRINSIC
Pfam:Cadherin_C 647 792 7e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000142129
AA Change: Y28C

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114507
Gene: ENSMUSG00000036510
AA Change: Y28C

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
CA 84 165 9.52e-17 SMART
CA 189 274 7.14e-30 SMART
CA 298 390 8.16e-16 SMART
CA 413 494 6.14e-20 SMART
CA 517 604 1.16e-11 SMART
transmembrane domain 622 644 N/A INTRINSIC
Pfam:Cadherin_C 645 702 5.3e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000142475
AA Change: Y28C

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115977
Gene: ENSMUSG00000036510
AA Change: Y28C

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
CA 84 165 9.52e-17 SMART
Pfam:Cadherin 172 242 2.2e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000145601
AA Change: Y28C

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122493
Gene: ENSMUSG00000036510
AA Change: Y28C

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
CA 84 165 9.52e-17 SMART
CA 189 274 7.14e-30 SMART
CA 298 390 8.16e-16 SMART
CA 413 502 1.27e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000155527
AA Change: Y28C

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123619
Gene: ENSMUSG00000036510
AA Change: Y28C

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
CA 84 165 9.52e-17 SMART
CA 189 274 7.14e-30 SMART
CA 298 390 8.16e-16 SMART
CA 413 494 6.14e-20 SMART
CA 517 604 1.16e-11 SMART
transmembrane domain 622 644 N/A INTRINSIC
Pfam:Cadherin_C 645 745 1.8e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161597
Meta Mutation Damage Score 0.012 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (39/39)
MGI Phenotype Strain: 3707077
FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Mice lacking the encoded protein exhibit reduced behavioral responses to cold, but not thermal stimuli. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele are viable, fertile and overtly normal but display abnormal CNS synaptic transmission, raise their tails in response to stress, and show reduced sensitivity to cutaneous cold stimuli. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy2 A G 13: 68,625,792 I1044T probably damaging Het
Arhgef4 T G 1: 34,723,981 F773V unknown Het
B4galnt4 A G 7: 141,068,659 N696S probably damaging Het
Cdh16 T A 8: 104,614,433 D786V probably benign Het
Cgn C T 3: 94,778,176 probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Chst10 A G 1: 38,868,047 V174A probably damaging Het
Clca4a T A 3: 144,966,413 N256I probably damaging Het
Cntnap5a G A 1: 116,412,106 W698* probably null Het
Ddx24 C A 12: 103,423,907 R275L probably damaging Het
Dnmt3b G T 2: 153,674,005 G444V probably damaging Het
Ermn A G 2: 58,051,759 F109S probably damaging Het
Fam227a C T 15: 79,640,694 A190T probably benign Het
Fstl4 T C 11: 53,176,977 W556R probably damaging Het
Fut2 T A 7: 45,650,380 I323F possibly damaging Het
Grik2 T G 10: 49,578,138 K94Q probably damaging Het
Hsd3b5 T C 3: 98,630,090 R37G possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Kmt2c A G 5: 25,443,818 probably null Het
Lrriq1 A T 10: 103,173,393 D1076E probably benign Het
Mical2 T A 7: 112,323,558 I590N probably damaging Het
Mycbp2 A G 14: 103,262,740 L940P possibly damaging Het
Nr6a1 T C 2: 38,739,071 I257V possibly damaging Het
Olfr1452-ps1 T A 19: 13,016,571 M116K probably damaging Het
Olfr812 A G 10: 129,842,907 L45P possibly damaging Het
Pcdhb17 A T 18: 37,486,263 probably null Het
Pdcl3 A G 1: 38,987,844 M1V probably null Het
Pdzd2 T A 15: 12,458,188 E196D probably damaging Het
Pgm1 G A 5: 64,116,415 C581Y probably benign Het
Pgm2 T C 4: 99,970,040 F379S possibly damaging Het
Plbd1 T A 6: 136,613,947 H407L probably benign Het
Prdm12 A G 2: 31,654,309 Y308C probably benign Het
Prdm15 T C 16: 97,799,055 E893G probably null Het
Slc17a2 A G 13: 23,815,022 T133A probably benign Het
Slc9a8 T A 2: 167,451,220 S163T probably damaging Het
Sult2a3 T C 7: 14,111,557 I126V probably benign Het
Tlr1 C T 5: 64,926,845 D130N probably damaging Het
Ugt3a2 A T 15: 9,361,518 K127* probably null Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Other mutations in Cdh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Cdh8 APN 8 99279690 missense probably damaging 0.99
IGL01377:Cdh8 APN 8 99033389 missense probably damaging 0.99
IGL01845:Cdh8 APN 8 99098954 splice site probably benign
IGL02166:Cdh8 APN 8 99190451 missense probably damaging 1.00
IGL02392:Cdh8 APN 8 99030755 missense probably damaging 0.96
R0007:Cdh8 UTSW 8 99230456 nonsense probably null
R0179:Cdh8 UTSW 8 99111712 missense possibly damaging 0.84
R0196:Cdh8 UTSW 8 99190434 missense probably damaging 0.99
R0220:Cdh8 UTSW 8 99111679 missense probably benign 0.21
R0271:Cdh8 UTSW 8 99111715 missense possibly damaging 0.83
R0592:Cdh8 UTSW 8 99279478 missense probably damaging 1.00
R0612:Cdh8 UTSW 8 99400914 missense probably benign 0.02
R1404:Cdh8 UTSW 8 99279618 missense probably damaging 1.00
R1404:Cdh8 UTSW 8 99279618 missense probably damaging 1.00
R1588:Cdh8 UTSW 8 99190407 missense probably damaging 1.00
R1635:Cdh8 UTSW 8 99031024 missense probably damaging 1.00
R1717:Cdh8 UTSW 8 99030705 missense probably damaging 1.00
R1781:Cdh8 UTSW 8 99190462 splice site probably null
R1781:Cdh8 UTSW 8 99279658 missense probably damaging 0.98
R1862:Cdh8 UTSW 8 99190394 missense probably damaging 1.00
R1895:Cdh8 UTSW 8 99279557 missense possibly damaging 0.84
R1912:Cdh8 UTSW 8 99098870 missense probably damaging 1.00
R2005:Cdh8 UTSW 8 99033471 splice site probably null
R2142:Cdh8 UTSW 8 99111693 missense probably damaging 1.00
R2197:Cdh8 UTSW 8 99196265 missense probably damaging 1.00
R2512:Cdh8 UTSW 8 99400863 missense probably benign 0.05
R3085:Cdh8 UTSW 8 99196386 missense probably benign 0.00
R3436:Cdh8 UTSW 8 99400718 splice site probably benign
R3898:Cdh8 UTSW 8 99171373 missense probably damaging 0.98
R4470:Cdh8 UTSW 8 99416689 unclassified probably benign
R4615:Cdh8 UTSW 8 99279622 missense probably damaging 1.00
R4652:Cdh8 UTSW 8 99024859 missense probably benign
R4666:Cdh8 UTSW 8 99024902 missense possibly damaging 0.71
R4798:Cdh8 UTSW 8 99024926 nonsense probably null
R4871:Cdh8 UTSW 8 99030904 missense probably damaging 1.00
R5170:Cdh8 UTSW 8 99279550 missense probably damaging 1.00
R5406:Cdh8 UTSW 8 99196370 missense probably damaging 1.00
R5564:Cdh8 UTSW 8 99030866 missense possibly damaging 0.57
R5686:Cdh8 UTSW 8 99033222 missense probably benign 0.00
R6786:Cdh8 UTSW 8 99223947 missense probably benign 0.19
R6855:Cdh8 UTSW 8 99190217 missense probably damaging 0.99
R6950:Cdh8 UTSW 8 99030763 missense probably benign 0.18
R7112:Cdh8 UTSW 8 99196352 missense probably damaging 1.00
R7181:Cdh8 UTSW 8 99098925 missense probably benign
R7384:Cdh8 UTSW 8 99230506 missense probably benign
R7400:Cdh8 UTSW 8 99279560 missense probably damaging 1.00
X0022:Cdh8 UTSW 8 99279475 missense probably damaging 1.00
Z1088:Cdh8 UTSW 8 99279502 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTTAAAATGAAGCTTACCCGGC -3'
(R):5'- TTCCCGGTTCTCTGAACACG -3'

Sequencing Primer
(F):5'- CCAACGAGAATCGGTTCAGGTC -3'
(R):5'- AGAGCTGTAAGTAACCCGCTTCG -3'
Posted On2018-04-02