Incidental Mutation 'R6312:Bmper'
ID509823
Institutional Source Beutler Lab
Gene Symbol Bmper
Ensembl Gene ENSMUSG00000031963
Gene NameBMP-binding endothelial regulator
SynonymsCV-2, Crim3, 3110056H04Rik, crossveinless-2, Cv2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6312 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location23223076-23485200 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 23406791 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 569 (Q569K)
Ref Sequence ENSEMBL: ENSMUSP00000071872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071982]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071982
AA Change: Q569K

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000071872
Gene: ENSMUSG00000031963
AA Change: Q569K

DomainStartEndE-ValueType
VWC 50 105 1.57e-2 SMART
VWC 108 163 1.89e-1 SMART
VWC 166 224 7.27e-7 SMART
VWC 238 289 3.34e-6 SMART
VWC 301 357 1.7e-7 SMART
VWD 355 513 3.75e-41 SMART
C8 553 625 1.07e-14 SMART
Pfam:TIL 629 682 2.5e-13 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000214050
AA Change: Q200K
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted protein that contains five Von Willebrand factor type C domains and a Von Willebrand factor type D domain and a trypsin inhibitory-like domain. The encoded protein binds to bone morphogenetic proteins (BMP) and regulates their activity. Mutation of the related gene in humans causes diaphanospondylodysostosis. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a knock-out mutation exhibit neonatal lethality associated with abnormal lung and skeleton development. Mice heterozygous for a null allele exhibit abnromal lung development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A G 12: 72,889,767 S472P possibly damaging Het
9430007A20Rik A T 4: 144,528,502 H164L probably benign Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
AC153874.1 T A 10: 77,847,127 probably benign Het
Acadvl T A 11: 70,011,767 M375L probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arl4d T C 11: 101,667,253 *202R probably null Het
B3gat2 G T 1: 23,815,467 E83* probably null Het
BC017158 T C 7: 128,273,543 K411R probably benign Het
C2cd4d C A 3: 94,364,435 P336H probably damaging Het
Cct2 A T 10: 117,056,055 S363T probably benign Het
Cers5 A G 15: 99,747,115 V119A probably benign Het
Cfhr2 C T 1: 139,831,079 V78I possibly damaging Het
Crocc2 A T 1: 93,215,710 K1345* probably null Het
Cyp4f39 T C 17: 32,483,294 M255T probably benign Het
Dpp6 A T 5: 27,725,671 I834F possibly damaging Het
Dpy19l4 T A 4: 11,289,671 K205* probably null Het
Epg5 T A 18: 77,979,211 D1056E possibly damaging Het
Fam20a A C 11: 109,674,630 C452G probably damaging Het
Gnai2 A T 9: 107,635,117 V34E probably damaging Het
Gng3 A G 19: 8,838,633 V7A probably benign Het
Hdc A G 2: 126,607,406 V77A possibly damaging Het
Hint1 G A 11: 54,869,990 C85Y probably benign Het
Kif17 C T 4: 138,288,193 S551L probably benign Het
Lgr5 A G 10: 115,452,924 L581P probably damaging Het
Lig4 G T 8: 9,971,739 N680K probably benign Het
Lipi T A 16: 75,573,915 Y138F probably damaging Het
Lrp2 C T 2: 69,436,681 G4294E probably damaging Het
Lrrc7 A G 3: 158,160,609 M1165T probably benign Het
Mtpap T C 18: 4,396,175 I489T possibly damaging Het
Nlrp1b T A 11: 71,228,397 N24I probably benign Het
Nlrp4a A G 7: 26,449,396 T143A probably benign Het
Nudt2 A G 4: 41,480,386 T90A probably benign Het
Olfr1055 A T 2: 86,347,581 F62I probably damaging Het
Olfr352 A T 2: 36,870,465 I300L probably benign Het
Olfr659 T A 7: 104,671,589 Y296N probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr883 TTGCTGT TTGCTGTCTGCTGT 9: 38,026,541 probably null Het
Olfr883 GTTT GTTTGCTGTTTT 9: 38,026,546 probably null Het
Olfr883 TTT TTTGCTGATT 9: 38,026,547 probably null Het
Olfr883 T TGCTGTTC 9: 38,026,549 probably null Het
Osmr A G 15: 6,823,638 V592A probably damaging Het
Rbp2 G T 9: 98,490,647 S13I probably benign Het
Rsf1 A AGGGCGACGG 7: 97,579,904 probably null Het
Slc6a7 A G 18: 61,002,385 S381P probably benign Het
Slitrk6 A G 14: 110,750,247 L676P probably benign Het
Sspo T C 6: 48,457,366 probably null Het
Tectb CT C 19: 55,192,662 probably null Homo
Tma16 T C 8: 66,481,466 E79G probably damaging Het
Trim14 G T 4: 46,507,257 H320N probably damaging Het
Trim63 A G 4: 134,325,697 D323G probably damaging Het
Vash2 C A 1: 190,958,683 R309L probably benign Het
Vmn1r62 G A 7: 5,676,084 V255M possibly damaging Het
Vmn2r53 T A 7: 12,598,639 probably null Het
Zfp382 G A 7: 30,134,538 R538H probably damaging Het
Zfp592 T A 7: 81,023,436 D49E probably benign Het
Zfp60 T C 7: 27,748,776 C290R probably damaging Het
Zfp69 G A 4: 120,949,517 probably benign Het
Zfp790 G T 7: 29,828,222 G111W probably damaging Het
Zfp948 T C 17: 21,587,167 I207T possibly damaging Het
Other mutations in Bmper
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Bmper APN 9 23406527 missense probably damaging 1.00
IGL00576:Bmper APN 9 23406603 missense probably damaging 1.00
IGL01115:Bmper APN 9 23399689 intron probably benign
IGL01978:Bmper APN 9 23381441 missense probably damaging 1.00
IGL02950:Bmper APN 9 23399494 missense probably damaging 1.00
IGL03193:Bmper APN 9 23366248 missense possibly damaging 0.46
PIT4469001:Bmper UTSW 9 23406549 missense probably benign 0.00
PIT4531001:Bmper UTSW 9 23224817 missense possibly damaging 0.90
R0047:Bmper UTSW 9 23406686 missense probably damaging 1.00
R0047:Bmper UTSW 9 23406686 missense probably damaging 1.00
R0173:Bmper UTSW 9 23224829 missense probably benign 0.02
R0504:Bmper UTSW 9 23406687 missense probably damaging 1.00
R0550:Bmper UTSW 9 23373885 missense probably benign 0.01
R0722:Bmper UTSW 9 23373928 missense probably benign 0.00
R2254:Bmper UTSW 9 23381463 missense possibly damaging 0.81
R2255:Bmper UTSW 9 23381463 missense possibly damaging 0.81
R2863:Bmper UTSW 9 23483941 missense probably benign
R2865:Bmper UTSW 9 23483941 missense probably benign
R3841:Bmper UTSW 9 23473431 splice site probably null
R4056:Bmper UTSW 9 23399629 missense probably benign
R4105:Bmper UTSW 9 23224763 missense probably benign 0.00
R4108:Bmper UTSW 9 23224763 missense probably benign 0.00
R4352:Bmper UTSW 9 23483952 missense probably benign
R4824:Bmper UTSW 9 23223660 missense possibly damaging 0.77
R4909:Bmper UTSW 9 23377725 missense probably benign 0.07
R5356:Bmper UTSW 9 23373861 missense probably benign 0.01
R5379:Bmper UTSW 9 23297224 missense probably benign 0.42
R5666:Bmper UTSW 9 23473463 missense probably damaging 1.00
R5670:Bmper UTSW 9 23473463 missense probably damaging 1.00
R5883:Bmper UTSW 9 23406674 missense probably benign 0.28
R5963:Bmper UTSW 9 23375593 missense probably benign 0.03
R6768:Bmper UTSW 9 23381453 missense probably damaging 1.00
R6897:Bmper UTSW 9 23373929 missense probably benign 0.01
R6907:Bmper UTSW 9 23399572 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGAACTTCAAGTTTGACGTG -3'
(R):5'- AGAAGACAAGCCTGGAATACTTC -3'

Sequencing Primer
(F):5'- GAACTTCAAGTTTGACGTGGATGAC -3'
(R):5'- TTTAGACAAGATGAGTTACTGAGCAG -3'
Posted On2018-04-02