Incidental Mutation 'R6316:Supt20'
ID509974
Institutional Source Beutler Lab
Gene Symbol Supt20
Ensembl Gene ENSMUSG00000027751
Gene Namesuppressor of Ty 20
SynonymsFam48a, p38IP, D3Ertd300e, p38 interacting protein
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R6316 (G1)
Quality Score217.468
Status Validated
Chromosome3
Chromosomal Location54692807-54728766 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) TCAGCAGCAGCAGCAGCAGCAGCA to TCAGCAGCAGCAGCAGCAGCAGCAGCA at 54727648 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029315] [ENSMUST00000029316] [ENSMUST00000153224] [ENSMUST00000154787] [ENSMUST00000197502] [ENSMUST00000199674] [ENSMUST00000200439] [ENSMUST00000200441]
Predicted Effect probably benign
Transcript: ENSMUST00000029315
SMART Domains Protein: ENSMUSP00000029315
Gene: ENSMUSG00000027751

DomainStartEndE-ValueType
low complexity region 65 78 N/A INTRINSIC
low complexity region 107 159 N/A INTRINSIC
coiled coil region 201 230 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000029316
SMART Domains Protein: ENSMUSP00000029316
Gene: ENSMUSG00000027752

DomainStartEndE-ValueType
Pfam:RNase_PH 31 166 2.3e-29 PFAM
Pfam:RNase_PH_C 191 258 8.9e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134892
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142377
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150923
Predicted Effect probably benign
Transcript: ENSMUST00000153224
SMART Domains Protein: ENSMUSP00000118780
Gene: ENSMUSG00000027752

DomainStartEndE-ValueType
Pfam:RNase_PH 31 130 2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154787
SMART Domains Protein: ENSMUSP00000115876
Gene: ENSMUSG00000027752

DomainStartEndE-ValueType
Pfam:RNase_PH 19 106 5.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197502
SMART Domains Protein: ENSMUSP00000143750
Gene: ENSMUSG00000027751

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 62 227 1.9e-43 PFAM
low complexity region 424 440 N/A INTRINSIC
low complexity region 467 476 N/A INTRINSIC
low complexity region 487 501 N/A INTRINSIC
low complexity region 512 532 N/A INTRINSIC
low complexity region 574 587 N/A INTRINSIC
low complexity region 632 680 N/A INTRINSIC
coiled coil region 722 751 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199674
SMART Domains Protein: ENSMUSP00000142948
Gene: ENSMUSG00000027751

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 59 227 3.3e-39 PFAM
low complexity region 424 442 N/A INTRINSIC
low complexity region 466 475 N/A INTRINSIC
low complexity region 486 500 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200439
SMART Domains Protein: ENSMUSP00000143059
Gene: ENSMUSG00000027751

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 59 227 2.7e-42 PFAM
low complexity region 424 440 N/A INTRINSIC
low complexity region 467 476 N/A INTRINSIC
low complexity region 487 501 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200441
SMART Domains Protein: ENSMUSP00000143231
Gene: ENSMUSG00000027751

DomainStartEndE-ValueType
low complexity region 65 78 N/A INTRINSIC
low complexity region 123 171 N/A INTRINSIC
coiled coil region 213 242 N/A INTRINSIC
Meta Mutation Damage Score 0.1228 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 98.0%
Validation Efficiency 97% (38/39)
MGI Phenotype PHENOTYPE: The incompletely penetrant homozygous phenotype of a splice-site mutation may include retinal epithelium expansion over the dorsal half of the eye, exencephaly, spina bifida, gastrulation defects and/or aberrant somite and mesoderm development. A few mutants survive postnatally and appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,313,959 T775A probably benign Het
Adam6a A T 12: 113,545,576 N523I probably benign Het
Adgrv1 T C 13: 81,499,068 T3118A possibly damaging Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Asxl3 A G 18: 22,522,782 Y1283C probably damaging Het
BC005561 G C 5: 104,519,729 G706R probably damaging Het
Btbd2 T A 10: 80,644,778 I319F probably damaging Het
Eno4 G A 19: 58,960,291 probably null Het
Glis2 T A 16: 4,613,836 probably benign Het
Grin2b A T 6: 135,780,279 C395S probably benign Het
H1foo T C 6: 115,948,915 probably null Het
Kansl1l T A 1: 66,735,585 Y694F probably benign Het
Kcnj1 A T 9: 32,397,336 E332V probably damaging Het
Klhdc7a T C 4: 139,966,802 E278G probably benign Het
Krt33a T C 11: 100,014,201 N160D probably damaging Het
Ksr2 A G 5: 117,685,502 N448S probably damaging Het
Lpar6 A G 14: 73,239,334 Y245C probably damaging Het
Magel2 T C 7: 62,378,719 I457T possibly damaging Het
Manf A G 9: 106,889,186 L132P probably damaging Het
Moxd2 T C 6: 40,883,547 D321G probably damaging Het
Mtmr12 T A 15: 12,236,113 C153S probably null Het
Muc16 T C 9: 18,641,819 T4393A probably benign Het
Notch3 T C 17: 32,137,813 probably null Het
Olfr311 A G 11: 58,841,942 Y276C probably damaging Het
Pirb T A 7: 3,717,823 K225N probably damaging Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Rilpl2 A G 5: 124,477,880 V69A probably damaging Het
Smdt1 T C 15: 82,348,009 V99A probably damaging Het
Smpd1 T C 7: 105,555,502 V196A probably benign Het
Tcte1 A G 17: 45,534,860 H130R probably benign Het
Tead1 C A 7: 112,891,839 Q296K probably damaging Het
Tmem163 C T 1: 127,551,365 S139N probably benign Het
Tor1aip2 G T 1: 156,062,094 D192Y probably damaging Het
Trgv2 G A 13: 19,336,742 Q61* probably null Het
Trib1 T C 15: 59,649,415 S85P probably benign Het
Trrap T A 5: 144,813,526 N1581K probably benign Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Xrn2 A G 2: 147,042,010 Y563C probably damaging Het
Other mutations in Supt20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Supt20 APN 3 54715169 missense probably damaging 0.98
IGL01781:Supt20 APN 3 54695205 start codon destroyed probably null 0.47
IGL02510:Supt20 APN 3 54715524 intron probably benign
IGL02656:Supt20 APN 3 54708395 missense probably damaging 1.00
IGL02958:Supt20 APN 3 54713723 intron probably benign
IGL03036:Supt20 APN 3 54709302 nonsense probably null
IGL03128:Supt20 APN 3 54708287 missense probably benign 0.05
IGL03164:Supt20 APN 3 54713188 missense probably benign 0.01
FR4304:Supt20 UTSW 3 54727647 small insertion probably benign
FR4304:Supt20 UTSW 3 54727662 small insertion probably benign
FR4304:Supt20 UTSW 3 54727664 nonsense probably null
FR4449:Supt20 UTSW 3 54727649 small insertion probably benign
FR4548:Supt20 UTSW 3 54727657 small insertion probably benign
FR4548:Supt20 UTSW 3 54727664 small insertion probably benign
FR4548:Supt20 UTSW 3 54727673 small insertion probably benign
FR4589:Supt20 UTSW 3 54727651 small insertion probably benign
FR4589:Supt20 UTSW 3 54727655 small insertion probably benign
FR4589:Supt20 UTSW 3 54727671 small insertion probably benign
FR4737:Supt20 UTSW 3 54727657 small insertion probably benign
FR4737:Supt20 UTSW 3 54727658 small insertion probably benign
FR4737:Supt20 UTSW 3 54727661 small insertion probably benign
R0383:Supt20 UTSW 3 54703149 nonsense probably null
R0675:Supt20 UTSW 3 54706969 missense probably damaging 1.00
R0744:Supt20 UTSW 3 54714701 missense probably damaging 1.00
R0968:Supt20 UTSW 3 54708400 intron probably benign
R1075:Supt20 UTSW 3 54706941 nonsense probably null
R1689:Supt20 UTSW 3 54712162 nonsense probably null
R1772:Supt20 UTSW 3 54710420 missense probably damaging 1.00
R1779:Supt20 UTSW 3 54714743 missense probably benign 0.00
R1829:Supt20 UTSW 3 54727658 utr 3 prime probably benign
R3236:Supt20 UTSW 3 54709080 missense possibly damaging 0.94
R3237:Supt20 UTSW 3 54709080 missense possibly damaging 0.94
R4989:Supt20 UTSW 3 54695134 utr 5 prime probably benign
R5180:Supt20 UTSW 3 54709085 missense probably benign 0.00
R5188:Supt20 UTSW 3 54710428 missense possibly damaging 0.87
R5423:Supt20 UTSW 3 54709325 missense probably damaging 1.00
R5627:Supt20 UTSW 3 54713190 missense possibly damaging 0.86
R5888:Supt20 UTSW 3 54712207 missense probably benign
R5995:Supt20 UTSW 3 54709053 missense probably damaging 0.97
R6623:Supt20 UTSW 3 54718294 missense possibly damaging 0.93
R6713:Supt20 UTSW 3 54698601 missense possibly damaging 0.89
R6874:Supt20 UTSW 3 54727754 intron probably null
R6988:Supt20 UTSW 3 54698597 missense probably damaging 1.00
R7149:Supt20 UTSW 3 54728411 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGCTAGAATGTCCAGGAATCAG -3'
(R):5'- GCTGACTGGCTTTTAACATGTCAG -3'

Sequencing Primer
(F):5'- TGTCCAGGAATCAGTGATATACCC -3'
(R):5'- CAGTGTACGGTACTTGTG -3'
Posted On2018-04-02