Incidental Mutation 'R6316:Plch1'
ID509975
Institutional Source Beutler Lab
Gene Symbol Plch1
Ensembl Gene ENSMUSG00000036834
Gene Namephospholipase C, eta 1
SynonymsPLCeta1, Plcl3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R6316 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location63696234-63899472 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 63781390 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 131 (W131*)
Ref Sequence ENSEMBL: ENSMUSP00000135424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048134] [ENSMUST00000059973] [ENSMUST00000084105] [ENSMUST00000159188] [ENSMUST00000159676] [ENSMUST00000160638] [ENSMUST00000162269] [ENSMUST00000175947] [ENSMUST00000177143]
Predicted Effect probably null
Transcript: ENSMUST00000048134
AA Change: W101*
SMART Domains Protein: ENSMUSP00000047693
Gene: ENSMUSG00000036834
AA Change: W101*

DomainStartEndE-ValueType
PH 3 112 2.37e-6 SMART
EFh 128 156 2.41e-4 SMART
EFh 164 193 1.54e-2 SMART
Pfam:EF-hand_like 198 280 2.2e-26 PFAM
PLCXc 281 426 3.13e-71 SMART
low complexity region 440 453 N/A INTRINSIC
low complexity region 564 581 N/A INTRINSIC
PLCYc 583 696 3.4e-49 SMART
C2 715 823 5.47e-22 SMART
low complexity region 979 997 N/A INTRINSIC
low complexity region 1079 1091 N/A INTRINSIC
low complexity region 1420 1435 N/A INTRINSIC
low complexity region 1543 1557 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000059973
AA Change: W119*
SMART Domains Protein: ENSMUSP00000058524
Gene: ENSMUSG00000036834
AA Change: W119*

DomainStartEndE-ValueType
PH 21 130 1.1e-8 SMART
EFh 146 174 1.1e-6 SMART
EFh 182 211 7.6e-5 SMART
Pfam:EF-hand_like 216 298 4.5e-24 PFAM
PLCXc 299 444 1.6e-73 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 582 599 N/A INTRINSIC
PLCYc 601 714 1.7e-51 SMART
C2 733 841 3.7e-24 SMART
low complexity region 1017 1035 N/A INTRINSIC
low complexity region 1117 1129 N/A INTRINSIC
low complexity region 1458 1473 N/A INTRINSIC
low complexity region 1581 1595 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000084105
AA Change: W119*
SMART Domains Protein: ENSMUSP00000081122
Gene: ENSMUSG00000036834
AA Change: W119*

DomainStartEndE-ValueType
PH 21 130 2.37e-6 SMART
EFh 146 174 2.41e-4 SMART
EFh 182 211 1.54e-2 SMART
Pfam:EF-hand_like 216 298 2.4e-27 PFAM
PLCXc 299 444 3.13e-71 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 583 600 N/A INTRINSIC
PLCYc 602 715 3.4e-49 SMART
C2 734 842 5.47e-22 SMART
low complexity region 1018 1036 N/A INTRINSIC
low complexity region 1118 1130 N/A INTRINSIC
low complexity region 1459 1474 N/A INTRINSIC
low complexity region 1582 1596 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159188
AA Change: W131*
SMART Domains Protein: ENSMUSP00000124491
Gene: ENSMUSG00000036834
AA Change: W131*

DomainStartEndE-ValueType
SCOP:d1mai__ 28 135 2e-29 SMART
PDB:1MAI|A 31 135 1e-5 PDB
Blast:PH 33 135 1e-72 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000159676
AA Change: W119*
SMART Domains Protein: ENSMUSP00000124632
Gene: ENSMUSG00000036834
AA Change: W119*

DomainStartEndE-ValueType
PH 21 130 2.37e-6 SMART
EFh 146 174 2.41e-4 SMART
EFh 182 211 1.54e-2 SMART
Pfam:EF-hand_like 216 298 1.8e-26 PFAM
PLCXc 299 444 3.13e-71 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 583 600 N/A INTRINSIC
PLCYc 602 715 3.4e-49 SMART
C2 734 842 5.47e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000160638
AA Change: W119*
SMART Domains Protein: ENSMUSP00000123921
Gene: ENSMUSG00000036834
AA Change: W119*

DomainStartEndE-ValueType
PH 21 130 2.37e-6 SMART
EFh 146 174 2.41e-4 SMART
EFh 182 211 1.54e-2 SMART
Pfam:EF-hand_like 216 298 5.3e-28 PFAM
PLCXc 299 444 3.13e-71 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 583 600 N/A INTRINSIC
PLCYc 602 715 3.4e-49 SMART
C2 734 842 5.47e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000162269
AA Change: W119*
SMART Domains Protein: ENSMUSP00000124463
Gene: ENSMUSG00000036834
AA Change: W119*

DomainStartEndE-ValueType
PH 21 130 2.37e-6 SMART
EFh 146 174 2.41e-4 SMART
EFh 182 211 1.54e-2 SMART
Pfam:EF-hand_like 216 298 1.7e-26 PFAM
PLCXc 299 444 3.13e-71 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 583 600 N/A INTRINSIC
PLCYc 602 715 3.4e-49 SMART
C2 734 842 5.47e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000175947
AA Change: W119*
SMART Domains Protein: ENSMUSP00000135353
Gene: ENSMUSG00000036834
AA Change: W119*

DomainStartEndE-ValueType
PH 21 130 2.37e-6 SMART
EFh 146 174 2.41e-4 SMART
EFh 182 211 1.54e-2 SMART
Pfam:EF-hand_like 216 298 1.2e-26 PFAM
PLCXc 299 444 3.13e-71 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 582 599 N/A INTRINSIC
PLCYc 601 714 3.4e-49 SMART
C2 733 841 5.47e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000177143
AA Change: W131*
SMART Domains Protein: ENSMUSP00000135424
Gene: ENSMUSG00000036834
AA Change: W131*

DomainStartEndE-ValueType
PH 33 142 2.37e-6 SMART
EFh 158 186 2.41e-4 SMART
EFh 194 223 1.54e-2 SMART
Pfam:EF-hand_like 228 310 2.3e-26 PFAM
PLCXc 311 456 3.13e-71 SMART
low complexity region 470 483 N/A INTRINSIC
low complexity region 594 611 N/A INTRINSIC
PLCYc 613 726 3.4e-49 SMART
C2 745 853 5.47e-22 SMART
low complexity region 1009 1027 N/A INTRINSIC
low complexity region 1109 1121 N/A INTRINSIC
low complexity region 1450 1465 N/A INTRINSIC
low complexity region 1573 1587 N/A INTRINSIC
Meta Mutation Damage Score 0.554 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 98.0%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PLCH1 is a member of the PLC-eta family of the phosphoinositide-specific phospholipase C (PLC) superfamily of enzymes that cleave phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2) to generate second messengers inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG) (Hwang et al., 2005 [PubMed 15702972]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,313,959 T775A probably benign Het
Adam6a A T 12: 113,545,576 N523I probably benign Het
Adgrv1 T C 13: 81,499,068 T3118A possibly damaging Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Asxl3 A G 18: 22,522,782 Y1283C probably damaging Het
BC005561 G C 5: 104,519,729 G706R probably damaging Het
Btbd2 T A 10: 80,644,778 I319F probably damaging Het
Eno4 G A 19: 58,960,291 probably null Het
Glis2 T A 16: 4,613,836 probably benign Het
Grin2b A T 6: 135,780,279 C395S probably benign Het
H1foo T C 6: 115,948,915 probably null Het
Kansl1l T A 1: 66,735,585 Y694F probably benign Het
Kcnj1 A T 9: 32,397,336 E332V probably damaging Het
Klhdc7a T C 4: 139,966,802 E278G probably benign Het
Krt33a T C 11: 100,014,201 N160D probably damaging Het
Ksr2 A G 5: 117,685,502 N448S probably damaging Het
Lpar6 A G 14: 73,239,334 Y245C probably damaging Het
Magel2 T C 7: 62,378,719 I457T possibly damaging Het
Manf A G 9: 106,889,186 L132P probably damaging Het
Moxd2 T C 6: 40,883,547 D321G probably damaging Het
Mtmr12 T A 15: 12,236,113 C153S probably null Het
Muc16 T C 9: 18,641,819 T4393A probably benign Het
Notch3 T C 17: 32,137,813 probably null Het
Olfr311 A G 11: 58,841,942 Y276C probably damaging Het
Pirb T A 7: 3,717,823 K225N probably damaging Het
Rilpl2 A G 5: 124,477,880 V69A probably damaging Het
Smdt1 T C 15: 82,348,009 V99A probably damaging Het
Smpd1 T C 7: 105,555,502 V196A probably benign Het
Supt20 TCAGCAGCAGCAGCAGCAGCAGCA TCAGCAGCAGCAGCAGCAGCAGCAGCA 3: 54,727,648 probably benign Het
Tcte1 A G 17: 45,534,860 H130R probably benign Het
Tead1 C A 7: 112,891,839 Q296K probably damaging Het
Tmem163 C T 1: 127,551,365 S139N probably benign Het
Tor1aip2 G T 1: 156,062,094 D192Y probably damaging Het
Trgv2 G A 13: 19,336,742 Q61* probably null Het
Trib1 T C 15: 59,649,415 S85P probably benign Het
Trrap T A 5: 144,813,526 N1581K probably benign Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Xrn2 A G 2: 147,042,010 Y563C probably damaging Het
Other mutations in Plch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:Plch1 APN 3 63731729 splice site probably null
IGL01542:Plch1 APN 3 63731649 missense probably damaging 0.99
IGL01999:Plch1 APN 3 63753307 missense probably damaging 1.00
IGL02153:Plch1 APN 3 63781351 missense probably damaging 1.00
IGL02203:Plch1 APN 3 63698739 missense possibly damaging 0.46
IGL02220:Plch1 APN 3 63698961 missense probably damaging 0.97
IGL02259:Plch1 APN 3 63722749 critical splice donor site probably null
IGL02268:Plch1 APN 3 63699283 makesense probably null
IGL02411:Plch1 APN 3 63697756 unclassified probably null
IGL02472:Plch1 APN 3 63701849 missense probably damaging 1.00
IGL02477:Plch1 APN 3 63753293 missense probably damaging 1.00
IGL02503:Plch1 APN 3 63697864 missense probably damaging 1.00
IGL02800:Plch1 APN 3 63698478 missense probably benign 0.21
IGL03167:Plch1 APN 3 63722744 splice site probably benign
IGL03182:Plch1 APN 3 63702594 nonsense probably null
IGL03197:Plch1 APN 3 63753170 missense probably damaging 1.00
IGL03251:Plch1 APN 3 63784002 missense possibly damaging 0.93
R0335:Plch1 UTSW 3 63710978 missense probably damaging 1.00
R0347:Plch1 UTSW 3 63753316 missense probably damaging 1.00
R0631:Plch1 UTSW 3 63699219 missense probably benign 0.23
R0687:Plch1 UTSW 3 63716029 missense probably damaging 1.00
R0738:Plch1 UTSW 3 63702553 intron probably benign
R0883:Plch1 UTSW 3 63753256 missense probably damaging 1.00
R1437:Plch1 UTSW 3 63697533 missense probably benign 0.37
R1678:Plch1 UTSW 3 63740694 missense probably damaging 1.00
R1738:Plch1 UTSW 3 63719238 missense probably benign 0.12
R1929:Plch1 UTSW 3 63744535 missense probably damaging 1.00
R1955:Plch1 UTSW 3 63755267 missense probably damaging 0.98
R2078:Plch1 UTSW 3 63701943 missense probably benign 0.01
R2112:Plch1 UTSW 3 63722806 missense probably damaging 1.00
R2158:Plch1 UTSW 3 63721234 missense probably benign 0.00
R2165:Plch1 UTSW 3 63698482 missense probably benign 0.01
R2259:Plch1 UTSW 3 63697977 missense possibly damaging 0.94
R2271:Plch1 UTSW 3 63744535 missense probably damaging 1.00
R3110:Plch1 UTSW 3 63709531 missense probably damaging 1.00
R3112:Plch1 UTSW 3 63709531 missense probably damaging 1.00
R3407:Plch1 UTSW 3 63699347 unclassified probably benign
R3408:Plch1 UTSW 3 63699347 unclassified probably benign
R3791:Plch1 UTSW 3 63699523 missense probably benign
R3793:Plch1 UTSW 3 63697831 missense probably damaging 0.96
R3928:Plch1 UTSW 3 63767623 missense probably damaging 1.00
R4211:Plch1 UTSW 3 63711219 missense probably damaging 1.00
R4212:Plch1 UTSW 3 63870759 start gained probably benign
R4223:Plch1 UTSW 3 63701900 missense probably damaging 1.00
R4491:Plch1 UTSW 3 63740739 missense probably damaging 1.00
R4589:Plch1 UTSW 3 63781507 missense probably damaging 1.00
R4656:Plch1 UTSW 3 63704177 missense probably damaging 1.00
R4701:Plch1 UTSW 3 63699496 intron probably null
R4716:Plch1 UTSW 3 63781546 missense probably damaging 1.00
R4772:Plch1 UTSW 3 63753325 missense probably damaging 1.00
R4902:Plch1 UTSW 3 63740843 intron probably benign
R5058:Plch1 UTSW 3 63722781 missense probably damaging 1.00
R5092:Plch1 UTSW 3 63698710 missense probably benign 0.02
R5093:Plch1 UTSW 3 63773715 missense probably damaging 0.99
R5210:Plch1 UTSW 3 63699778 critical splice donor site probably null
R5368:Plch1 UTSW 3 63701973 missense possibly damaging 0.82
R5373:Plch1 UTSW 3 63698078 missense probably benign 0.01
R5374:Plch1 UTSW 3 63698078 missense probably benign 0.01
R5501:Plch1 UTSW 3 63707741 missense probably damaging 1.00
R5606:Plch1 UTSW 3 63740687 missense probably benign 0.35
R5738:Plch1 UTSW 3 63773655 missense probably damaging 1.00
R5835:Plch1 UTSW 3 63697522 missense probably benign
R6106:Plch1 UTSW 3 63702023 missense probably damaging 1.00
R6107:Plch1 UTSW 3 63702023 missense probably damaging 1.00
R6108:Plch1 UTSW 3 63702023 missense probably damaging 1.00
R6110:Plch1 UTSW 3 63698858 missense possibly damaging 0.62
R6116:Plch1 UTSW 3 63702023 missense probably damaging 1.00
R6147:Plch1 UTSW 3 63722881 missense probably damaging 1.00
R6195:Plch1 UTSW 3 63740789 missense probably damaging 1.00
R6315:Plch1 UTSW 3 63781390 nonsense probably null
R6317:Plch1 UTSW 3 63781390 nonsense probably null
R6318:Plch1 UTSW 3 63781390 nonsense probably null
R6324:Plch1 UTSW 3 63781390 nonsense probably null
R6325:Plch1 UTSW 3 63781390 nonsense probably null
R6326:Plch1 UTSW 3 63781390 nonsense probably null
R6479:Plch1 UTSW 3 63744510 missense probably benign 0.06
R6544:Plch1 UTSW 3 63850978 missense probably damaging 1.00
R6767:Plch1 UTSW 3 63755344 missense probably damaging 1.00
R6829:Plch1 UTSW 3 63697518 missense probably damaging 0.99
R6891:Plch1 UTSW 3 63698083 missense probably benign
R6893:Plch1 UTSW 3 63753141 nonsense probably null
R6921:Plch1 UTSW 3 63707734 missense possibly damaging 0.90
X0028:Plch1 UTSW 3 63744509 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CATGTGCTCGTATGCTCGTG -3'
(R):5'- AGCACCACCTTAAGGCAATG -3'

Sequencing Primer
(F):5'- ATGCTCGTGTGTGCACATGC -3'
(R):5'- ACCAATAAATGTCTTTACCTGCC -3'
Posted On2018-04-02