Incidental Mutation 'R6316:BC005561'
ID509977
Institutional Source Beutler Lab
Gene Symbol BC005561
Ensembl Gene ENSMUSG00000079065
Gene NamecDNA sequence BC005561
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_001166581; MGI: 3040669

Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R6316 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location104508352-104522611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 104519729 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 706 (G706R)
Ref Sequence ENSEMBL: ENSMUSP00000130629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096452]
Predicted Effect probably damaging
Transcript: ENSMUST00000096452
AA Change: G706R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130629
Gene: ENSMUSG00000079065
AA Change: G706R

DomainStartEndE-ValueType
Pfam:THOC2_N 10 424 3.5e-65 PFAM
Pfam:THOC2_N 415 566 5.8e-32 PFAM
Pfam:Thoc2 568 643 8.3e-40 PFAM
low complexity region 729 747 N/A INTRINSIC
Pfam:Tho2 873 1173 1.1e-105 PFAM
low complexity region 1251 1262 N/A INTRINSIC
low complexity region 1266 1283 N/A INTRINSIC
coiled coil region 1310 1335 N/A INTRINSIC
low complexity region 1355 1366 N/A INTRINSIC
low complexity region 1459 1482 N/A INTRINSIC
low complexity region 1524 1543 N/A INTRINSIC
low complexity region 1561 1569 N/A INTRINSIC
Meta Mutation Damage Score 0.59 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 98.0%
Validation Efficiency 97% (38/39)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,313,959 T775A probably benign Het
Adam6a A T 12: 113,545,576 N523I probably benign Het
Adgrv1 T C 13: 81,499,068 T3118A possibly damaging Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Asxl3 A G 18: 22,522,782 Y1283C probably damaging Het
Btbd2 T A 10: 80,644,778 I319F probably damaging Het
Eno4 G A 19: 58,960,291 probably null Het
Glis2 T A 16: 4,613,836 probably benign Het
Grin2b A T 6: 135,780,279 C395S probably benign Het
H1foo T C 6: 115,948,915 probably null Het
Kansl1l T A 1: 66,735,585 Y694F probably benign Het
Kcnj1 A T 9: 32,397,336 E332V probably damaging Het
Klhdc7a T C 4: 139,966,802 E278G probably benign Het
Krt33a T C 11: 100,014,201 N160D probably damaging Het
Ksr2 A G 5: 117,685,502 N448S probably damaging Het
Lpar6 A G 14: 73,239,334 Y245C probably damaging Het
Magel2 T C 7: 62,378,719 I457T possibly damaging Het
Manf A G 9: 106,889,186 L132P probably damaging Het
Moxd2 T C 6: 40,883,547 D321G probably damaging Het
Mtmr12 T A 15: 12,236,113 C153S probably null Het
Muc16 T C 9: 18,641,819 T4393A probably benign Het
Notch3 T C 17: 32,137,813 probably null Het
Olfr311 A G 11: 58,841,942 Y276C probably damaging Het
Pirb T A 7: 3,717,823 K225N probably damaging Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Rilpl2 A G 5: 124,477,880 V69A probably damaging Het
Smdt1 T C 15: 82,348,009 V99A probably damaging Het
Smpd1 T C 7: 105,555,502 V196A probably benign Het
Supt20 TCAGCAGCAGCAGCAGCAGCAGCA TCAGCAGCAGCAGCAGCAGCAGCAGCA 3: 54,727,648 probably benign Het
Tcte1 A G 17: 45,534,860 H130R probably benign Het
Tead1 C A 7: 112,891,839 Q296K probably damaging Het
Tmem163 C T 1: 127,551,365 S139N probably benign Het
Tor1aip2 G T 1: 156,062,094 D192Y probably damaging Het
Trgv2 G A 13: 19,336,742 Q61* probably null Het
Trib1 T C 15: 59,649,415 S85P probably benign Het
Trrap T A 5: 144,813,526 N1581K probably benign Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Xrn2 A G 2: 147,042,010 Y563C probably damaging Het
Other mutations in BC005561
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:BC005561 APN 5 104520500 missense probably damaging 1.00
IGL01024:BC005561 APN 5 104521746 missense probably benign 0.02
IGL01133:BC005561 APN 5 104517662 missense probably benign
IGL01564:BC005561 APN 5 104520663 missense probably benign 0.12
IGL01727:BC005561 APN 5 104519513 missense probably benign 0.01
IGL02086:BC005561 APN 5 104519001 missense possibly damaging 0.49
IGL02153:BC005561 APN 5 104521083 missense probably benign 0.02
IGL02256:BC005561 APN 5 104520283 nonsense probably null
IGL02436:BC005561 APN 5 104521155 missense probably benign 0.10
IGL02969:BC005561 APN 5 104519343 missense probably benign 0.01
IGL03275:BC005561 APN 5 104518277 missense probably benign 0.00
IGL03357:BC005561 APN 5 104520468 missense probably damaging 1.00
F2404:BC005561 UTSW 5 104520230 missense possibly damaging 0.83
R0318:BC005561 UTSW 5 104517753 missense probably benign 0.00
R0349:BC005561 UTSW 5 104519976 missense possibly damaging 0.85
R0454:BC005561 UTSW 5 104518211 missense probably benign 0.45
R0742:BC005561 UTSW 5 104522154 missense probably benign 0.00
R0842:BC005561 UTSW 5 104519200 missense possibly damaging 0.81
R0882:BC005561 UTSW 5 104519009 missense probably benign 0.05
R1123:BC005561 UTSW 5 104518470 missense probably damaging 1.00
R1171:BC005561 UTSW 5 104520903 missense possibly damaging 0.49
R1205:BC005561 UTSW 5 104520213 missense probably benign 0.28
R1261:BC005561 UTSW 5 104520635 missense probably damaging 0.98
R1432:BC005561 UTSW 5 104518104 missense probably damaging 1.00
R1447:BC005561 UTSW 5 104522204 missense possibly damaging 0.89
R1466:BC005561 UTSW 5 104518257 missense probably damaging 0.99
R1466:BC005561 UTSW 5 104518257 missense probably damaging 0.99
R1584:BC005561 UTSW 5 104518257 missense probably damaging 0.99
R1636:BC005561 UTSW 5 104520750 missense probably damaging 0.99
R1686:BC005561 UTSW 5 104519923 nonsense probably null
R1698:BC005561 UTSW 5 104520510 missense probably benign 0.09
R1816:BC005561 UTSW 5 104517834 missense probably benign 0.16
R1903:BC005561 UTSW 5 104518330 missense probably benign 0.00
R2096:BC005561 UTSW 5 104519969 missense possibly damaging 0.95
R2146:BC005561 UTSW 5 104518991 missense probably benign
R2226:BC005561 UTSW 5 104519420 missense probably damaging 1.00
R2227:BC005561 UTSW 5 104519420 missense probably damaging 1.00
R2383:BC005561 UTSW 5 104518988 missense probably benign 0.23
R2656:BC005561 UTSW 5 104519315 missense probably benign 0.05
R3982:BC005561 UTSW 5 104521023 missense probably benign 0.29
R3983:BC005561 UTSW 5 104521023 missense probably benign 0.29
R4115:BC005561 UTSW 5 104519433 missense probably damaging 1.00
R4345:BC005561 UTSW 5 104521449 missense probably benign 0.21
R4697:BC005561 UTSW 5 104522240 missense probably benign 0.00
R4711:BC005561 UTSW 5 104519661 missense probably damaging 0.98
R4742:BC005561 UTSW 5 104518857 missense probably benign 0.17
R4758:BC005561 UTSW 5 104520399 missense possibly damaging 0.48
R4863:BC005561 UTSW 5 104517750 missense possibly damaging 0.89
R4867:BC005561 UTSW 5 104521002 missense possibly damaging 0.91
R5024:BC005561 UTSW 5 104522258 missense possibly damaging 0.68
R5114:BC005561 UTSW 5 104519876 missense probably damaging 0.99
R5117:BC005561 UTSW 5 104520255 missense probably damaging 1.00
R5289:BC005561 UTSW 5 104519657 missense probably benign 0.03
R5341:BC005561 UTSW 5 104518076 missense probably damaging 1.00
R5420:BC005561 UTSW 5 104518359 missense probably damaging 0.99
R5421:BC005561 UTSW 5 104518395 missense probably benign 0.01
R5422:BC005561 UTSW 5 104519646 missense probably damaging 0.98
R5606:BC005561 UTSW 5 104521878 missense probably benign 0.00
R5939:BC005561 UTSW 5 104519207 missense possibly damaging 0.56
R6104:BC005561 UTSW 5 104518218 missense probably damaging 1.00
R6169:BC005561 UTSW 5 104518396 missense probably benign 0.00
R6352:BC005561 UTSW 5 104520198 missense probably benign 0.11
R6408:BC005561 UTSW 5 104518777 missense probably benign 0.19
R6458:BC005561 UTSW 5 104522303 missense probably benign 0.02
R6722:BC005561 UTSW 5 104520279 missense probably damaging 0.99
R6789:BC005561 UTSW 5 104517689 missense probably benign 0.00
R7214:BC005561 UTSW 5 104522363 missense probably benign
R7494:BC005561 UTSW 5 104518418 missense not run
Predicted Primers PCR Primer
(F):5'- TGGCTTCAGAGTCTGGCTAG -3'
(R):5'- ACTGGTCATATAGCTTTCCCAC -3'

Sequencing Primer
(F):5'- CTGTGGTGCAGTTTTTCGTAAATACC -3'
(R):5'- AGCTTTCCCACAAGTTTCAAATG -3'
Posted On2018-04-02