Mutagenetix > Incidental Mutation

Incidental Mutation 'R6316:Grin2b'

509983

Institutional Source

Beutler Lab

Gene Symbol

Grin2b

Ensembl Gene

ENSMUSG00000030209

Gene Name

glutamate receptor, ionotropic, NMDA2B (epsilon 2)

Synonyms

GluRepsilon2, GluN2B, NR2B, NMDAR2B, Nmdar2b

MMRRC Submission

044416-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6316 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

135690231-136150509 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 135757277 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 395 (C395S)

Ref Sequence

ENSEMBL: ENSMUSP00000107536 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000053880
AA Change: C395S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: C395S

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	106	306	8.6e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	4.8e-270	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111905
AA Change: C395S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: C395S

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	56	307	4.2e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	2.1e-245	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 98.0%

Validation Efficiency

97% (38/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	T	C	1: 71,353,118 (GRCm39)	T775A	probably benign	Het
Adam6a	A	T	12: 113,509,196 (GRCm39)	N523I	probably benign	Het
Adgrv1	T	C	13: 81,647,187 (GRCm39)	T3118A	possibly damaging	Het
Arhgef4	G	A	1: 34,762,558 (GRCm39)	A605T	unknown	Het
Asxl3	A	G	18: 22,655,839 (GRCm39)	Y1283C	probably damaging	Het
Btbd2	T	A	10: 80,480,612 (GRCm39)	I319F	probably damaging	Het
Eno4	G	A	19: 58,948,723 (GRCm39)		probably null	Het
Glis2	T	A	16: 4,431,700 (GRCm39)		probably benign	Het
H1f8	T	C	6: 115,925,876 (GRCm39)		probably null	Het
Kansl1l	T	A	1: 66,774,744 (GRCm39)	Y694F	probably benign	Het
Kcnj1	A	T	9: 32,308,632 (GRCm39)	E332V	probably damaging	Het
Klhdc7a	T	C	4: 139,694,113 (GRCm39)	E278G	probably benign	Het
Krt33a	T	C	11: 99,905,027 (GRCm39)	N160D	probably damaging	Het
Ksr2	A	G	5: 117,823,567 (GRCm39)	N448S	probably damaging	Het
Lpar6	A	G	14: 73,476,774 (GRCm39)	Y245C	probably damaging	Het
Magel2	T	C	7: 62,028,467 (GRCm39)	I457T	possibly damaging	Het
Manf	A	G	9: 106,766,385 (GRCm39)	L132P	probably damaging	Het
Moxd2	T	C	6: 40,860,481 (GRCm39)	D321G	probably damaging	Het
Mtmr12	T	A	15: 12,236,199 (GRCm39)	C153S	probably null	Het
Muc16	T	C	9: 18,553,115 (GRCm39)	T4393A	probably benign	Het
Notch3	T	C	17: 32,356,787 (GRCm39)		probably null	Het
Or9e1	A	G	11: 58,732,768 (GRCm39)	Y276C	probably damaging	Het
Pirb	T	A	7: 3,720,822 (GRCm39)	K225N	probably damaging	Het
Plch1	C	T	3: 63,688,811 (GRCm39)	W131*	probably null	Het
Rilpl2	A	G	5: 124,615,943 (GRCm39)	V69A	probably damaging	Het
Smdt1	T	C	15: 82,232,210 (GRCm39)	V99A	probably damaging	Het
Smpd1	T	C	7: 105,204,709 (GRCm39)	V196A	probably benign	Het
Supt20	TCAGCAGCAGCAGCAGCAGCAGCA	TCAGCAGCAGCAGCAGCAGCAGCAGCA	3: 54,635,069 (GRCm39)		probably benign	Het
Tcte1	A	G	17: 45,845,786 (GRCm39)	H130R	probably benign	Het
Tead1	C	A	7: 112,491,046 (GRCm39)	Q296K	probably damaging	Het
Thoc2l	G	C	5: 104,667,595 (GRCm39)	G706R	probably damaging	Het
Tmem163	C	T	1: 127,479,102 (GRCm39)	S139N	probably benign	Het
Tor1aip2	G	T	1: 155,937,840 (GRCm39)	D192Y	probably damaging	Het
Trgv2	G	A	13: 19,520,912 (GRCm39)	Q61*	probably null	Het
Trib1	T	C	15: 59,521,264 (GRCm39)	S85P	probably benign	Het
Trrap	T	A	5: 144,750,336 (GRCm39)	N1581K	probably benign	Het
Vmn1r181	G	A	7: 23,684,183 (GRCm39)	R216Q	probably benign	Het
Xrn2	A	G	2: 146,883,930 (GRCm39)	Y563C	probably damaging	Het

Other mutations in Grin2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00494:Grin2b	APN	6	135,713,329 (GRCm39)	missense	possibly damaging	0.55
IGL00835:Grin2b	APN	6	135,710,568 (GRCm39)	missense	probably damaging	1.00
IGL01401:Grin2b	APN	6	135,713,361 (GRCm39)	missense	probably damaging	1.00
IGL01523:Grin2b	APN	6	136,021,263 (GRCm39)	missense	probably null	0.99
IGL01719:Grin2b	APN	6	135,710,379 (GRCm39)	missense	probably damaging	0.97
IGL01907:Grin2b	APN	6	135,710,738 (GRCm39)	missense	probably damaging	1.00
IGL01996:Grin2b	APN	6	135,709,584 (GRCm39)	missense	probably damaging	1.00
IGL02309:Grin2b	APN	6	135,713,470 (GRCm39)	missense	probably damaging	1.00
IGL02312:Grin2b	APN	6	135,716,088 (GRCm39)	missense	probably damaging	1.00
IGL02409:Grin2b	APN	6	136,020,906 (GRCm39)	missense	possibly damaging	0.89
IGL02527:Grin2b	APN	6	135,900,389 (GRCm39)	missense	probably damaging	1.00
IGL02535:Grin2b	APN	6	135,756,367 (GRCm39)	missense	possibly damaging	0.70
IGL02570:Grin2b	APN	6	135,899,996 (GRCm39)	missense	probably damaging	1.00
IGL02702:Grin2b	APN	6	135,716,130 (GRCm39)	missense	probably damaging	0.99
IGL03001:Grin2b	APN	6	135,716,113 (GRCm39)	missense	probably damaging	1.00
IGL03274:Grin2b	APN	6	135,757,253 (GRCm39)	missense	possibly damaging	0.90
R0055:Grin2b	UTSW	6	135,900,201 (GRCm39)	missense	probably benign
R0055:Grin2b	UTSW	6	135,900,201 (GRCm39)	missense	probably benign
R0164:Grin2b	UTSW	6	135,755,646 (GRCm39)	splice site	probably benign
R0194:Grin2b	UTSW	6	135,756,303 (GRCm39)	missense	probably damaging	1.00
R0594:Grin2b	UTSW	6	135,710,927 (GRCm39)	missense	probably damaging	1.00
R1434:Grin2b	UTSW	6	135,820,193 (GRCm39)	missense	probably benign	0.04
R1928:Grin2b	UTSW	6	136,021,044 (GRCm39)	missense	probably damaging	1.00
R1942:Grin2b	UTSW	6	135,709,730 (GRCm39)	missense	possibly damaging	0.93
R1996:Grin2b	UTSW	6	136,021,209 (GRCm39)	missense	possibly damaging	0.52
R2002:Grin2b	UTSW	6	135,710,243 (GRCm39)	missense	probably damaging	1.00
R2020:Grin2b	UTSW	6	135,710,894 (GRCm39)	missense	probably benign	0.12
R2103:Grin2b	UTSW	6	135,757,138 (GRCm39)	missense	probably benign	0.02
R2127:Grin2b	UTSW	6	135,755,698 (GRCm39)	missense	probably benign	0.03
R2495:Grin2b	UTSW	6	135,710,180 (GRCm39)	missense	probably damaging	1.00
R2656:Grin2b	UTSW	6	135,710,427 (GRCm39)	missense	probably damaging	1.00
R2847:Grin2b	UTSW	6	135,717,951 (GRCm39)	missense	probably damaging	1.00
R2866:Grin2b	UTSW	6	135,710,637 (GRCm39)	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135,710,637 (GRCm39)	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135,710,637 (GRCm39)	missense	probably damaging	1.00
R3196:Grin2b	UTSW	6	135,709,453 (GRCm39)	small deletion	probably benign
R3418:Grin2b	UTSW	6	135,820,108 (GRCm39)	missense	probably benign	0.02
R3808:Grin2b	UTSW	6	135,900,269 (GRCm39)	missense	probably damaging	0.99
R4028:Grin2b	UTSW	6	135,713,433 (GRCm39)	missense	probably damaging	1.00
R4602:Grin2b	UTSW	6	135,755,739 (GRCm39)	missense	probably damaging	1.00
R4624:Grin2b	UTSW	6	135,710,823 (GRCm39)	missense	probably damaging	0.99
R4677:Grin2b	UTSW	6	135,751,870 (GRCm39)	missense	probably benign	0.13
R4744:Grin2b	UTSW	6	135,755,697 (GRCm39)	missense	probably damaging	1.00
R5020:Grin2b	UTSW	6	135,710,405 (GRCm39)	missense	probably benign	0.01
R5051:Grin2b	UTSW	6	135,756,393 (GRCm39)	missense	possibly damaging	0.84
R5105:Grin2b	UTSW	6	135,709,439 (GRCm39)	missense	probably benign	0.03
R5125:Grin2b	UTSW	6	135,900,297 (GRCm39)	missense	possibly damaging	0.89
R5146:Grin2b	UTSW	6	135,756,340 (GRCm39)	missense	probably damaging	1.00
R5318:Grin2b	UTSW	6	135,710,916 (GRCm39)	missense	probably damaging	0.99
R5349:Grin2b	UTSW	6	136,021,281 (GRCm39)	missense	possibly damaging	0.93
R5426:Grin2b	UTSW	6	135,709,366 (GRCm39)	missense	probably damaging	1.00
R5438:Grin2b	UTSW	6	135,713,304 (GRCm39)	missense	probably damaging	1.00
R5439:Grin2b	UTSW	6	135,713,304 (GRCm39)	missense	probably damaging	1.00
R5440:Grin2b	UTSW	6	135,713,304 (GRCm39)	missense	probably damaging	1.00
R5530:Grin2b	UTSW	6	135,710,721 (GRCm39)	missense	probably benign	0.00
R5603:Grin2b	UTSW	6	135,900,395 (GRCm39)	missense	probably damaging	1.00
R5657:Grin2b	UTSW	6	135,710,085 (GRCm39)	missense	possibly damaging	0.48
R5788:Grin2b	UTSW	6	135,717,962 (GRCm39)	missense	probably benign	0.24
R5941:Grin2b	UTSW	6	135,713,371 (GRCm39)	missense	probably damaging	0.99
R6057:Grin2b	UTSW	6	135,710,942 (GRCm39)	missense	possibly damaging	0.84
R6137:Grin2b	UTSW	6	135,900,456 (GRCm39)	missense	possibly damaging	0.89
R6216:Grin2b	UTSW	6	135,749,397 (GRCm39)	missense	probably damaging	1.00
R6309:Grin2b	UTSW	6	135,710,025 (GRCm39)	missense	probably benign	0.00
R6419:Grin2b	UTSW	6	135,717,965 (GRCm39)	missense	probably damaging	1.00
R6551:Grin2b	UTSW	6	135,710,342 (GRCm39)	missense	probably damaging	1.00
R6612:Grin2b	UTSW	6	135,717,996 (GRCm39)	missense	probably damaging	1.00
R6616:Grin2b	UTSW	6	135,709,549 (GRCm39)	missense	probably benign
R6647:Grin2b	UTSW	6	135,710,108 (GRCm39)	missense	probably damaging	1.00
R6806:Grin2b	UTSW	6	135,751,826 (GRCm39)	missense	possibly damaging	0.84
R6976:Grin2b	UTSW	6	135,757,198 (GRCm39)	missense	probably benign
R7033:Grin2b	UTSW	6	135,900,036 (GRCm39)	missense	probably damaging	1.00
R7058:Grin2b	UTSW	6	135,757,304 (GRCm39)	missense	probably damaging	0.97
R7144:Grin2b	UTSW	6	135,710,474 (GRCm39)	missense	possibly damaging	0.50
R7190:Grin2b	UTSW	6	135,709,946 (GRCm39)	missense	possibly damaging	0.46
R7238:Grin2b	UTSW	6	135,757,249 (GRCm39)	missense	probably damaging	0.97
R7453:Grin2b	UTSW	6	135,717,947 (GRCm39)	missense	possibly damaging	0.56
R7553:Grin2b	UTSW	6	135,749,394 (GRCm39)	missense	possibly damaging	0.88
R7585:Grin2b	UTSW	6	135,756,301 (GRCm39)	missense	probably damaging	0.99
R7615:Grin2b	UTSW	6	135,900,362 (GRCm39)	missense	probably damaging	1.00
R7632:Grin2b	UTSW	6	135,709,553 (GRCm39)	missense	probably benign	0.02
R7779:Grin2b	UTSW	6	135,755,792 (GRCm39)	nonsense	probably null
R8058:Grin2b	UTSW	6	135,710,225 (GRCm39)	missense	probably damaging	1.00
R8084:Grin2b	UTSW	6	135,710,486 (GRCm39)	missense	probably benign	0.03
R8145:Grin2b	UTSW	6	135,709,497 (GRCm39)	missense	probably benign	0.01
R8308:Grin2b	UTSW	6	135,900,074 (GRCm39)	missense	probably damaging	0.99
R8357:Grin2b	UTSW	6	135,709,197 (GRCm39)	missense	probably benign	0.00
R8379:Grin2b	UTSW	6	135,899,967 (GRCm39)	missense	probably damaging	1.00
R8429:Grin2b	UTSW	6	135,710,914 (GRCm39)	missense	probably damaging	1.00
R8457:Grin2b	UTSW	6	135,709,197 (GRCm39)	missense	probably benign	0.00
R8746:Grin2b	UTSW	6	135,899,985 (GRCm39)	missense	probably benign	0.02
R8925:Grin2b	UTSW	6	135,749,339 (GRCm39)	missense	probably damaging	0.97
R8927:Grin2b	UTSW	6	135,749,339 (GRCm39)	missense	probably damaging	0.97
R8963:Grin2b	UTSW	6	136,021,007 (GRCm39)	missense	probably damaging	1.00
R9075:Grin2b	UTSW	6	135,709,509 (GRCm39)	frame shift	probably null
R9076:Grin2b	UTSW	6	135,709,509 (GRCm39)	frame shift	probably null
R9172:Grin2b	UTSW	6	135,756,255 (GRCm39)	missense	possibly damaging	0.84
R9520:Grin2b	UTSW	6	135,710,399 (GRCm39)	missense	probably damaging	1.00
R9740:Grin2b	UTSW	6	135,899,868 (GRCm39)	critical splice donor site	probably null
RF001:Grin2b	UTSW	6	136,021,238 (GRCm39)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATTTCAGAGGGTGCCTAGCTC -3'
(R):5'- GGAATTGTTTTGCCCTTGCTTAAC -3'

Sequencing Primer
(F):5'- AGCACATCTGACTCTCCTGGG -3'
(R):5'- CAGCTTCTAAGACAATTCAGAGAG -3'

Posted On

2018-04-02