Incidental Mutation 'R6317:Atp1a2'
ID510010
Institutional Source Beutler Lab
Gene Symbol Atp1a2
Ensembl Gene ENSMUSG00000007097
Gene NameATPase, Na+/K+ transporting, alpha 2 polypeptide
SynonymsAtpa-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6317 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location172271709-172298064 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 172289336 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Proline at position 238 (R238P)
Ref Sequence ENSEMBL: ENSMUSP00000095072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085913] [ENSMUST00000097464] [ENSMUST00000139528]
Predicted Effect probably damaging
Transcript: ENSMUST00000085913
AA Change: R238P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000083077
Gene: ENSMUSG00000007097
AA Change: R238P

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
Cation_ATPase_N 40 114 5.28e-19 SMART
Pfam:E1-E2_ATPase 132 363 2.5e-59 PFAM
Pfam:Hydrolase 368 726 4.5e-19 PFAM
Pfam:HAD 371 723 3.2e-18 PFAM
Pfam:Cation_ATPase 424 518 1.9e-25 PFAM
Pfam:Cation_ATPase_C 796 1005 1.4e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097464
AA Change: R238P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095072
Gene: ENSMUSG00000007097
AA Change: R238P

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
Cation_ATPase_N 40 114 5.28e-19 SMART
Pfam:E1-E2_ATPase 133 364 1.9e-63 PFAM
Pfam:Hydrolase 368 726 2e-32 PFAM
Pfam:HAD 371 723 1.7e-15 PFAM
Pfam:Hydrolase_like2 424 518 1.3e-26 PFAM
Pfam:Cation_ATPase_C 796 947 3.2e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131751
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137679
SMART Domains Protein: ENSMUSP00000117873
Gene: ENSMUSG00000007097

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
Cation_ATPase_N 40 114 5.28e-19 SMART
Pfam:E1-E2_ATPase 133 364 1.2e-63 PFAM
Pfam:Hydrolase 368 613 8.5e-9 PFAM
Pfam:Hydrolase_like2 424 518 5.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139528
SMART Domains Protein: ENSMUSP00000134280
Gene: ENSMUSG00000038034

DomainStartEndE-ValueType
IG_like 19 84 3.66e1 SMART
low complexity region 92 103 N/A INTRINSIC
IG 106 222 2.3e-3 SMART
IG 246 370 9.49e-5 SMART
IG 382 508 3.59e-5 SMART
transmembrane domain 515 537 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155363
Meta Mutation Damage Score 0.168 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 2 subunit. Mutations in this gene result in familial basilar or hemiplegic migraines, and in a rare syndrome known as alternating hemiplegia of childhood. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutants die immediately after birth from breathing failure, lack spontaneous respiratory rhythm activity, have elevated levels of extracellular GABA in the brain, and have abnormal chloride homeostasis in brainstem neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T C 18: 70,468,193 N206S probably damaging Het
Abcf2 A T 5: 24,569,158 Y315* probably null Het
Adck1 T G 12: 88,402,151 V133G probably damaging Het
Aoc2 T C 11: 101,325,466 F125S probably damaging Het
As3mt A G 19: 46,724,971 D319G probably benign Het
Baz1a T C 12: 54,954,800 Q145R possibly damaging Het
BC067074 T A 13: 113,368,268 L1977H probably benign Het
Bhlhe22 A G 3: 18,055,614 E276G probably damaging Het
Cdo1 C A 18: 46,728,037 V36L probably benign Het
Ces1h A G 8: 93,357,418 F388S unknown Het
Col6a5 T A 9: 105,889,067 N1885Y probably damaging Het
Corin A T 5: 72,339,045 C522S probably damaging Het
Csmd1 G T 8: 16,710,642 T159K possibly damaging Het
Cwc27 T A 13: 104,804,261 K197* probably null Het
Cyp20a1 T C 1: 60,352,124 S26P probably damaging Het
Daxx T A 17: 33,911,975 D321E probably damaging Het
Gria2 A C 3: 80,741,004 Y142D possibly damaging Het
Gspt1 T C 16: 11,223,208 probably null Het
Ighv1-80 A T 12: 115,912,645 V17D probably damaging Het
Ints4 T A 7: 97,529,218 L675* probably null Het
Kif13a C T 13: 46,826,757 R173Q probably damaging Het
Map3k2 T C 18: 32,203,033 I91T probably damaging Het
Map3k8 A G 18: 4,348,979 probably null Het
Mcemp1 G A 8: 3,667,284 W101* probably null Het
Mgea5 A T 19: 45,771,680 probably null Het
Naca T C 10: 128,044,124 I1675T probably benign Het
Nol9 T C 4: 152,041,057 F155S probably damaging Het
Obscn C A 11: 59,069,895 D3406Y probably damaging Het
Obsl1 A G 1: 75,489,629 V1485A possibly damaging Het
Olfr151 T C 9: 37,730,429 K185E possibly damaging Het
Otog C A 7: 46,301,215 P337H probably damaging Het
Patl1 T C 19: 11,920,878 L140P probably damaging Het
Pcca G A 14: 122,582,623 V60M probably damaging Het
Pex11g G T 8: 3,464,092 D23E probably damaging Het
Phactr2 A T 10: 13,261,882 M172K probably damaging Het
Plce1 G A 19: 38,524,530 W91* probably null Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Podn A G 4: 108,027,160 F44S probably damaging Het
Polr3e A G 7: 120,927,982 D87G possibly damaging Het
Prmt2 T A 10: 76,222,517 I153F probably benign Het
Prpf6 T C 2: 181,631,436 V258A probably benign Het
Ptpn21 G T 12: 98,689,262 A482E probably damaging Het
Qrich1 A T 9: 108,534,292 N339Y probably damaging Het
Rabgap1 T A 2: 37,542,647 V750D possibly damaging Het
Reg3d G A 6: 78,377,445 P58S probably damaging Het
Rp1 A G 1: 4,041,989 L1213P unknown Het
Sema6b A G 17: 56,124,047 L872S probably benign Het
Serpinb7 T C 1: 107,451,706 I281T probably damaging Het
Shank2 T C 7: 144,285,084 V685A possibly damaging Het
Slc28a2 A G 2: 122,454,499 I323V possibly damaging Het
Slc7a6 A T 8: 106,192,467 I228F probably damaging Het
Slc9a9 A G 9: 94,939,459 T300A possibly damaging Het
Spta1 A G 1: 174,241,087 N2151S probably damaging Het
Sult2a1 T A 7: 13,836,020 I96L probably benign Het
Tgm2 T C 2: 158,124,150 D528G probably benign Het
Ubl7 T C 9: 57,911,173 probably null Het
Vcan T A 13: 89,691,597 I983L probably benign Het
Vmn1r172 T C 7: 23,660,317 L209P probably damaging Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Vmn1r3 T C 4: 3,184,993 S105G probably benign Het
Zfp644 A T 5: 106,635,845 H945Q probably damaging Het
Other mutations in Atp1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Atp1a2 APN 1 172276002 missense probably damaging 1.00
IGL00954:Atp1a2 APN 1 172290634 missense probably damaging 1.00
IGL01083:Atp1a2 APN 1 172284619 missense probably benign
IGL01372:Atp1a2 APN 1 172278943 missense probably damaging 1.00
IGL01762:Atp1a2 APN 1 172284913 missense possibly damaging 0.89
IGL01896:Atp1a2 APN 1 172286011 missense probably damaging 1.00
IGL01942:Atp1a2 APN 1 172286309 missense probably benign 0.35
IGL01944:Atp1a2 APN 1 172276187 missense probably damaging 0.98
IGL02219:Atp1a2 APN 1 172279718 missense probably damaging 1.00
IGL02219:Atp1a2 APN 1 172279731 nonsense probably null
IGL02304:Atp1a2 APN 1 172289353 missense probably benign
IGL02507:Atp1a2 APN 1 172285771 missense probably damaging 1.00
IGL02557:Atp1a2 APN 1 172278651 missense possibly damaging 0.83
IGL02632:Atp1a2 APN 1 172280614 missense possibly damaging 0.89
IGL03053:Atp1a2 APN 1 172278356 missense probably damaging 1.00
IGL03104:Atp1a2 APN 1 172293367 missense probably damaging 0.97
IGL03161:Atp1a2 APN 1 172278862 intron probably benign
IGL03218:Atp1a2 APN 1 172289303 missense probably null 0.82
PIT4151001:Atp1a2 UTSW 1 172290721 missense probably damaging 0.99
PIT4520001:Atp1a2 UTSW 1 172279374 missense probably benign 0.00
R0121:Atp1a2 UTSW 1 172289342 missense probably damaging 0.99
R0630:Atp1a2 UTSW 1 172291275 missense possibly damaging 0.78
R0682:Atp1a2 UTSW 1 172284597 missense probably benign 0.00
R0755:Atp1a2 UTSW 1 172289381 missense probably benign 0.37
R1413:Atp1a2 UTSW 1 172279344 missense probably damaging 1.00
R1680:Atp1a2 UTSW 1 172278954 missense probably damaging 0.99
R2094:Atp1a2 UTSW 1 172287433 missense probably damaging 1.00
R3714:Atp1a2 UTSW 1 172278984 missense probably damaging 0.96
R4573:Atp1a2 UTSW 1 172278637 missense possibly damaging 0.75
R4928:Atp1a2 UTSW 1 172278387 missense possibly damaging 0.93
R4953:Atp1a2 UTSW 1 172291442 intron probably benign
R5014:Atp1a2 UTSW 1 172284871 missense probably benign 0.05
R5080:Atp1a2 UTSW 1 172284445 intron probably benign
R5129:Atp1a2 UTSW 1 172275955 missense probably benign 0.02
R5360:Atp1a2 UTSW 1 172278869 critical splice donor site probably null
R5619:Atp1a2 UTSW 1 172279381 missense probably damaging 0.99
R5622:Atp1a2 UTSW 1 172291427 intron probably benign
R5718:Atp1a2 UTSW 1 172279442 missense probably damaging 1.00
R5729:Atp1a2 UTSW 1 172293371 missense probably damaging 0.99
R5909:Atp1a2 UTSW 1 172287230 missense probably damaging 1.00
R6018:Atp1a2 UTSW 1 172298012 intron probably benign
R6145:Atp1a2 UTSW 1 172287238 missense probably damaging 1.00
R6164:Atp1a2 UTSW 1 172278892 missense probably damaging 0.97
R6315:Atp1a2 UTSW 1 172289336 missense probably damaging 0.99
R6319:Atp1a2 UTSW 1 172289336 missense probably damaging 0.99
R6323:Atp1a2 UTSW 1 172289336 missense probably damaging 0.99
R6324:Atp1a2 UTSW 1 172289336 missense probably damaging 0.99
R6374:Atp1a2 UTSW 1 172289375 missense probably damaging 1.00
R6764:Atp1a2 UTSW 1 172284614 missense probably benign
R6812:Atp1a2 UTSW 1 172284877 missense probably benign 0.20
R7025:Atp1a2 UTSW 1 172284550 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACTACTACCGCAACGTTCAG -3'
(R):5'- GCCATAAATATGTGATGAGGGC -3'

Sequencing Primer
(F):5'- GCAACGTTCAGTTCCCTCAATG -3'
(R):5'- CCTTCTTGTCATGAAGATTGAGG -3'
Posted On2018-04-02