Incidental Mutation 'R6317:Spta1'
ID510011
Institutional Source Beutler Lab
Gene Symbol Spta1
Ensembl Gene ENSMUSG00000026532
Gene Namespectrin alpha, erythrocytic 1
Synonymserythroid, Spna-1, ihj, Spna1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.506) question?
Stock #R6317 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location174172776-174248450 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 174241087 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 2151 (N2151S)
Ref Sequence ENSEMBL: ENSMUSP00000027817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027817]
Predicted Effect probably damaging
Transcript: ENSMUST00000027817
AA Change: N2151S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027817
Gene: ENSMUSG00000026532
AA Change: N2151S

DomainStartEndE-ValueType
SPEC 55 153 3.62e-11 SMART
SPEC 159 259 1.84e-26 SMART
SPEC 265 365 1.56e-24 SMART
SPEC 371 471 8.35e-25 SMART
SPEC 477 577 1.19e-29 SMART
SPEC 583 682 2.43e-26 SMART
SPEC 688 788 1.3e-26 SMART
SPEC 794 894 1.66e-28 SMART
SPEC 900 1077 5.03e-19 SMART
SH3 978 1033 2.98e-15 SMART
SPEC 1083 1178 2.57e-16 SMART
SPEC 1184 1284 1.15e-27 SMART
SPEC 1290 1390 7.05e-23 SMART
SPEC 1396 1495 6.04e-22 SMART
SPEC 1501 1602 1.15e-27 SMART
SPEC 1608 1708 5.46e-29 SMART
SPEC 1714 1814 1.08e-32 SMART
SPEC 1820 1921 2.17e-23 SMART
SPEC 1927 2028 2.19e-19 SMART
SPEC 2042 2142 3.87e-11 SMART
SPEC 2156 2253 9.77e-8 SMART
low complexity region 2307 2318 N/A INTRINSIC
efhand_Ca_insen 2346 2414 2.37e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156092
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is a tetramer made up of alpha-beta dimers linked in a head-to-head arrangement. This gene is one member of a family of alpha-spectrin genes. The encoded protein is primarily composed of 22 spectrin repeats which are involved in dimer formation. It forms weaker tetramer interactions than non-erythrocytic alpha spectrin, which may increase the plasma membrane elasticity and deformability of red blood cells. Mutations in this gene result in a variety of hereditary red blood cell disorders, including elliptocytosis type 2, pyropoikilocytosis, and spherocytic hemolytic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit microcytic, hypochromic, hemolytic anemia, jaundice, and high neonatal mortality. Heterozygotes of some alleles may exhibit a mild spherocytic transition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T C 18: 70,468,193 N206S probably damaging Het
Abcf2 A T 5: 24,569,158 Y315* probably null Het
Adck1 T G 12: 88,402,151 V133G probably damaging Het
Aoc2 T C 11: 101,325,466 F125S probably damaging Het
As3mt A G 19: 46,724,971 D319G probably benign Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
Baz1a T C 12: 54,954,800 Q145R possibly damaging Het
BC067074 T A 13: 113,368,268 L1977H probably benign Het
Bhlhe22 A G 3: 18,055,614 E276G probably damaging Het
Cdo1 C A 18: 46,728,037 V36L probably benign Het
Ces1h A G 8: 93,357,418 F388S unknown Het
Col6a5 T A 9: 105,889,067 N1885Y probably damaging Het
Corin A T 5: 72,339,045 C522S probably damaging Het
Csmd1 G T 8: 16,710,642 T159K possibly damaging Het
Cwc27 T A 13: 104,804,261 K197* probably null Het
Cyp20a1 T C 1: 60,352,124 S26P probably damaging Het
Daxx T A 17: 33,911,975 D321E probably damaging Het
Gria2 A C 3: 80,741,004 Y142D possibly damaging Het
Gspt1 T C 16: 11,223,208 probably null Het
Ighv1-80 A T 12: 115,912,645 V17D probably damaging Het
Ints4 T A 7: 97,529,218 L675* probably null Het
Kif13a C T 13: 46,826,757 R173Q probably damaging Het
Map3k2 T C 18: 32,203,033 I91T probably damaging Het
Map3k8 A G 18: 4,348,979 probably null Het
Mcemp1 G A 8: 3,667,284 W101* probably null Het
Mgea5 A T 19: 45,771,680 probably null Het
Naca T C 10: 128,044,124 I1675T probably benign Het
Nol9 T C 4: 152,041,057 F155S probably damaging Het
Obscn C A 11: 59,069,895 D3406Y probably damaging Het
Obsl1 A G 1: 75,489,629 V1485A possibly damaging Het
Olfr151 T C 9: 37,730,429 K185E possibly damaging Het
Otog C A 7: 46,301,215 P337H probably damaging Het
Patl1 T C 19: 11,920,878 L140P probably damaging Het
Pcca G A 14: 122,582,623 V60M probably damaging Het
Pex11g G T 8: 3,464,092 D23E probably damaging Het
Phactr2 A T 10: 13,261,882 M172K probably damaging Het
Plce1 G A 19: 38,524,530 W91* probably null Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Podn A G 4: 108,027,160 F44S probably damaging Het
Polr3e A G 7: 120,927,982 D87G possibly damaging Het
Prmt2 T A 10: 76,222,517 I153F probably benign Het
Prpf6 T C 2: 181,631,436 V258A probably benign Het
Ptpn21 G T 12: 98,689,262 A482E probably damaging Het
Qrich1 A T 9: 108,534,292 N339Y probably damaging Het
Rabgap1 T A 2: 37,542,647 V750D possibly damaging Het
Reg3d G A 6: 78,377,445 P58S probably damaging Het
Rp1 A G 1: 4,041,989 L1213P unknown Het
Sema6b A G 17: 56,124,047 L872S probably benign Het
Serpinb7 T C 1: 107,451,706 I281T probably damaging Het
Shank2 T C 7: 144,285,084 V685A possibly damaging Het
Slc28a2 A G 2: 122,454,499 I323V possibly damaging Het
Slc7a6 A T 8: 106,192,467 I228F probably damaging Het
Slc9a9 A G 9: 94,939,459 T300A possibly damaging Het
Sult2a1 T A 7: 13,836,020 I96L probably benign Het
Tgm2 T C 2: 158,124,150 D528G probably benign Het
Ubl7 T C 9: 57,911,173 probably null Het
Vcan T A 13: 89,691,597 I983L probably benign Het
Vmn1r172 T C 7: 23,660,317 L209P probably damaging Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Vmn1r3 T C 4: 3,184,993 S105G probably benign Het
Zfp644 A T 5: 106,635,845 H945Q probably damaging Het
Other mutations in Spta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Spta1 APN 1 174208390 nonsense probably null
IGL01095:Spta1 APN 1 174213485 missense probably benign 0.02
IGL01144:Spta1 APN 1 174187263 missense probably benign 0.05
IGL01455:Spta1 APN 1 174203311 missense possibly damaging 0.78
IGL01541:Spta1 APN 1 174217159 missense probably benign 0.03
IGL01613:Spta1 APN 1 174208394 missense probably damaging 1.00
IGL01804:Spta1 APN 1 174244180 missense probably benign 0.42
IGL01859:Spta1 APN 1 174174372 missense probably damaging 1.00
IGL01898:Spta1 APN 1 174213862 missense probably benign 0.00
IGL02106:Spta1 APN 1 174203294 missense probably benign 0.02
IGL02166:Spta1 APN 1 174190231 missense probably damaging 1.00
IGL02224:Spta1 APN 1 174217689 critical splice donor site probably benign
IGL02318:Spta1 APN 1 174174463 missense possibly damaging 0.51
IGL02392:Spta1 APN 1 174218814 missense probably damaging 0.96
IGL02852:Spta1 APN 1 174244110 missense probably benign 0.24
IGL02861:Spta1 APN 1 174211598 missense probably damaging 1.00
IGL02982:Spta1 APN 1 174187288 missense probably benign 0.00
IGL03057:Spta1 APN 1 174181058 missense probably benign 0.19
IGL03215:Spta1 APN 1 174218743 missense probably damaging 1.00
IGL03263:Spta1 APN 1 174213918 missense probably damaging 0.99
IGL03272:Spta1 APN 1 174214144 missense probably benign 0.08
H8786:Spta1 UTSW 1 174179839 missense probably damaging 0.98
R0003:Spta1 UTSW 1 174205273 missense probably damaging 0.98
R0003:Spta1 UTSW 1 174205273 missense probably damaging 0.98
R0010:Spta1 UTSW 1 174217943 missense probably benign 0.03
R0010:Spta1 UTSW 1 174217943 missense probably benign 0.03
R0078:Spta1 UTSW 1 174207032 splice site probably benign
R0172:Spta1 UTSW 1 174230786 missense probably damaging 1.00
R0206:Spta1 UTSW 1 174192960 missense probably damaging 1.00
R0208:Spta1 UTSW 1 174192960 missense probably damaging 1.00
R0276:Spta1 UTSW 1 174217894 missense probably damaging 1.00
R0288:Spta1 UTSW 1 174243179 missense probably damaging 0.99
R0323:Spta1 UTSW 1 174218451 missense probably damaging 1.00
R0454:Spta1 UTSW 1 174213942 missense probably damaging 1.00
R0508:Spta1 UTSW 1 174224457 missense probably damaging 1.00
R0698:Spta1 UTSW 1 174181104 missense probably damaging 1.00
R0751:Spta1 UTSW 1 174184690 missense probably damaging 1.00
R0925:Spta1 UTSW 1 174174426 missense possibly damaging 0.85
R0941:Spta1 UTSW 1 174245205 unclassified probably benign
R1131:Spta1 UTSW 1 174185647 missense probably damaging 1.00
R1171:Spta1 UTSW 1 174211614 nonsense probably null
R1184:Spta1 UTSW 1 174184690 missense probably damaging 1.00
R1401:Spta1 UTSW 1 174222684 missense probably damaging 1.00
R1489:Spta1 UTSW 1 174231325 missense probably damaging 0.97
R1532:Spta1 UTSW 1 174247353 missense probably damaging 0.99
R1551:Spta1 UTSW 1 174240166 missense possibly damaging 0.94
R1555:Spta1 UTSW 1 174178749 missense probably damaging 0.99
R1566:Spta1 UTSW 1 174184706 missense probably benign 0.00
R1586:Spta1 UTSW 1 174213495 missense probably benign 0.00
R1676:Spta1 UTSW 1 174179839 missense probably damaging 0.98
R1711:Spta1 UTSW 1 174241042 missense probably damaging 1.00
R1795:Spta1 UTSW 1 174245730 missense probably damaging 1.00
R1823:Spta1 UTSW 1 174246549 missense probably benign 0.05
R1842:Spta1 UTSW 1 174195947 missense probably benign 0.00
R1867:Spta1 UTSW 1 174219839 missense probably benign 0.33
R1970:Spta1 UTSW 1 174240367 missense possibly damaging 0.88
R2042:Spta1 UTSW 1 174211647 missense probably benign 0.20
R2095:Spta1 UTSW 1 174244198 missense possibly damaging 0.75
R2125:Spta1 UTSW 1 174208344 missense possibly damaging 0.80
R2145:Spta1 UTSW 1 174212614 missense probably benign 0.00
R2158:Spta1 UTSW 1 174229258 missense probably benign 0.41
R2187:Spta1 UTSW 1 174192966 missense probably damaging 1.00
R2250:Spta1 UTSW 1 174244114 missense probably damaging 1.00
R2258:Spta1 UTSW 1 174174341 missense possibly damaging 0.76
R2319:Spta1 UTSW 1 174178656 critical splice acceptor site probably null
R3782:Spta1 UTSW 1 174208314 missense probably damaging 1.00
R4058:Spta1 UTSW 1 174241137 missense probably damaging 1.00
R4080:Spta1 UTSW 1 174214066 missense probably benign 0.00
R4081:Spta1 UTSW 1 174214066 missense probably benign 0.00
R4082:Spta1 UTSW 1 174214066 missense probably benign 0.00
R4108:Spta1 UTSW 1 174174556 missense probably benign 0.01
R4115:Spta1 UTSW 1 174240357 missense probably damaging 1.00
R4303:Spta1 UTSW 1 174179852 missense probably damaging 1.00
R4419:Spta1 UTSW 1 174247424 nonsense probably null
R4525:Spta1 UTSW 1 174207110 missense probably null 1.00
R4614:Spta1 UTSW 1 174192977 missense probably damaging 1.00
R4673:Spta1 UTSW 1 174191062 splice site probably null
R4782:Spta1 UTSW 1 174230666 missense probably benign 0.01
R4825:Spta1 UTSW 1 174244042 critical splice acceptor site probably null
R4829:Spta1 UTSW 1 174237927 missense probably benign 0.01
R4873:Spta1 UTSW 1 174175830 missense probably damaging 1.00
R4875:Spta1 UTSW 1 174175830 missense probably damaging 1.00
R4898:Spta1 UTSW 1 174237834 missense possibly damaging 0.94
R4910:Spta1 UTSW 1 174217863 splice site probably null
R4911:Spta1 UTSW 1 174185647 missense probably damaging 1.00
R4928:Spta1 UTSW 1 174191056 missense probably benign 0.15
R4959:Spta1 UTSW 1 174246608 missense probably damaging 0.97
R5009:Spta1 UTSW 1 174240223 missense possibly damaging 0.62
R5149:Spta1 UTSW 1 174247434 missense probably damaging 0.99
R5293:Spta1 UTSW 1 174195985 missense probably damaging 0.99
R5421:Spta1 UTSW 1 174215529 missense probably damaging 0.99
R5457:Spta1 UTSW 1 174217193 missense probably damaging 1.00
R5590:Spta1 UTSW 1 174175770 missense possibly damaging 0.73
R5606:Spta1 UTSW 1 174219902 missense probably damaging 1.00
R5736:Spta1 UTSW 1 174214255 critical splice donor site probably null
R5834:Spta1 UTSW 1 174184797 intron probably null
R5845:Spta1 UTSW 1 174241096 missense probably damaging 0.97
R5987:Spta1 UTSW 1 174223328 missense probably damaging 1.00
R6102:Spta1 UTSW 1 174224520 missense probably benign 0.01
R6221:Spta1 UTSW 1 174181776 missense probably damaging 1.00
R6276:Spta1 UTSW 1 174218512 missense probably damaging 1.00
R6329:Spta1 UTSW 1 174214177 missense possibly damaging 0.60
R6352:Spta1 UTSW 1 174211646 missense possibly damaging 0.94
R6374:Spta1 UTSW 1 174214168 missense probably damaging 1.00
R6376:Spta1 UTSW 1 174203322 missense probably benign
R6387:Spta1 UTSW 1 174231333 missense probably benign 0.01
R6451:Spta1 UTSW 1 174217201 missense probably damaging 0.97
R6480:Spta1 UTSW 1 174187148 intron probably null
R6533:Spta1 UTSW 1 174244147 missense probably damaging 1.00
R6585:Spta1 UTSW 1 174178685 missense probably damaging 1.00
R6695:Spta1 UTSW 1 174244042 critical splice acceptor site probably null
R6945:Spta1 UTSW 1 174209325 missense possibly damaging 0.89
R7020:Spta1 UTSW 1 174209352 missense probably damaging 1.00
R7086:Spta1 UTSW 1 174199484 missense probably damaging 0.98
R7087:Spta1 UTSW 1 174174510 missense probably benign
R7151:Spta1 UTSW 1 174197751 missense probably damaging 1.00
T0722:Spta1 UTSW 1 174191066 splice site probably benign
X0028:Spta1 UTSW 1 174224450 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGTGCACCTATGGAAGATAG -3'
(R):5'- GCTTATTGGGTGCTCAATGC -3'

Sequencing Primer
(F):5'- AGGTTATCTTGGAAATAGAAATGTGC -3'
(R):5'- CGACCTTGAGTGAGACAGTTTATC -3'
Posted On2018-04-02