Incidental Mutation 'R6317:Slc28a2'
ID510013
Institutional Source Beutler Lab
Gene Symbol Slc28a2
Ensembl Gene ENSMUSG00000027219
Gene Namesolute carrier family 28 (sodium-coupled nucleoside transporter), member 2
SynonymsCNT2, 2010208B10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R6317 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location122426477-122461137 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122454499 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 323 (I323V)
Ref Sequence ENSEMBL: ENSMUSP00000106154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028652] [ENSMUST00000110524] [ENSMUST00000110525]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028652
AA Change: I323V

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000028652
Gene: ENSMUSG00000027219
AA Change: I323V

DomainStartEndE-ValueType
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 147 166 N/A INTRINSIC
Pfam:Nucleos_tra2_N 180 253 1.5e-28 PFAM
Pfam:Gate 260 360 7.9e-11 PFAM
Pfam:Nucleos_tra2_C 363 587 1e-74 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110524
AA Change: I323V

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106153
Gene: ENSMUSG00000027219
AA Change: I323V

DomainStartEndE-ValueType
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 147 166 N/A INTRINSIC
Pfam:Nucleos_tra2_N 180 254 8.6e-26 PFAM
Pfam:Gate 260 387 2.5e-9 PFAM
Pfam:Nucleos_tra2_C 363 588 5.1e-74 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110525
AA Change: I323V

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106154
Gene: ENSMUSG00000027219
AA Change: I323V

DomainStartEndE-ValueType
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 147 166 N/A INTRINSIC
Pfam:Nucleos_tra2_N 180 254 8.6e-26 PFAM
Pfam:Gate 260 387 2.5e-9 PFAM
Pfam:Nucleos_tra2_C 363 588 5.1e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153848
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T C 18: 70,468,193 N206S probably damaging Het
Abcf2 A T 5: 24,569,158 Y315* probably null Het
Adck1 T G 12: 88,402,151 V133G probably damaging Het
Aoc2 T C 11: 101,325,466 F125S probably damaging Het
As3mt A G 19: 46,724,971 D319G probably benign Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
Baz1a T C 12: 54,954,800 Q145R possibly damaging Het
BC067074 T A 13: 113,368,268 L1977H probably benign Het
Bhlhe22 A G 3: 18,055,614 E276G probably damaging Het
Cdo1 C A 18: 46,728,037 V36L probably benign Het
Ces1h A G 8: 93,357,418 F388S unknown Het
Col6a5 T A 9: 105,889,067 N1885Y probably damaging Het
Corin A T 5: 72,339,045 C522S probably damaging Het
Csmd1 G T 8: 16,710,642 T159K possibly damaging Het
Cwc27 T A 13: 104,804,261 K197* probably null Het
Cyp20a1 T C 1: 60,352,124 S26P probably damaging Het
Daxx T A 17: 33,911,975 D321E probably damaging Het
Gria2 A C 3: 80,741,004 Y142D possibly damaging Het
Gspt1 T C 16: 11,223,208 probably null Het
Ighv1-80 A T 12: 115,912,645 V17D probably damaging Het
Ints4 T A 7: 97,529,218 L675* probably null Het
Kif13a C T 13: 46,826,757 R173Q probably damaging Het
Map3k2 T C 18: 32,203,033 I91T probably damaging Het
Map3k8 A G 18: 4,348,979 probably null Het
Mcemp1 G A 8: 3,667,284 W101* probably null Het
Mgea5 A T 19: 45,771,680 probably null Het
Naca T C 10: 128,044,124 I1675T probably benign Het
Nol9 T C 4: 152,041,057 F155S probably damaging Het
Obscn C A 11: 59,069,895 D3406Y probably damaging Het
Obsl1 A G 1: 75,489,629 V1485A possibly damaging Het
Olfr151 T C 9: 37,730,429 K185E possibly damaging Het
Otog C A 7: 46,301,215 P337H probably damaging Het
Patl1 T C 19: 11,920,878 L140P probably damaging Het
Pcca G A 14: 122,582,623 V60M probably damaging Het
Pex11g G T 8: 3,464,092 D23E probably damaging Het
Phactr2 A T 10: 13,261,882 M172K probably damaging Het
Plce1 G A 19: 38,524,530 W91* probably null Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Podn A G 4: 108,027,160 F44S probably damaging Het
Polr3e A G 7: 120,927,982 D87G possibly damaging Het
Prmt2 T A 10: 76,222,517 I153F probably benign Het
Prpf6 T C 2: 181,631,436 V258A probably benign Het
Ptpn21 G T 12: 98,689,262 A482E probably damaging Het
Qrich1 A T 9: 108,534,292 N339Y probably damaging Het
Rabgap1 T A 2: 37,542,647 V750D possibly damaging Het
Reg3d G A 6: 78,377,445 P58S probably damaging Het
Rp1 A G 1: 4,041,989 L1213P unknown Het
Sema6b A G 17: 56,124,047 L872S probably benign Het
Serpinb7 T C 1: 107,451,706 I281T probably damaging Het
Shank2 T C 7: 144,285,084 V685A possibly damaging Het
Slc7a6 A T 8: 106,192,467 I228F probably damaging Het
Slc9a9 A G 9: 94,939,459 T300A possibly damaging Het
Spta1 A G 1: 174,241,087 N2151S probably damaging Het
Sult2a1 T A 7: 13,836,020 I96L probably benign Het
Tgm2 T C 2: 158,124,150 D528G probably benign Het
Ubl7 T C 9: 57,911,173 probably null Het
Vcan T A 13: 89,691,597 I983L probably benign Het
Vmn1r172 T C 7: 23,660,317 L209P probably damaging Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Vmn1r3 T C 4: 3,184,993 S105G probably benign Het
Zfp644 A T 5: 106,635,845 H945Q probably damaging Het
Other mutations in Slc28a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Slc28a2 APN 2 122452057 missense probably damaging 1.00
IGL01404:Slc28a2 APN 2 122452057 missense probably damaging 1.00
IGL01559:Slc28a2 APN 2 122454540 missense probably damaging 1.00
IGL02016:Slc28a2 APN 2 122455341 missense probably benign 0.01
IGL02503:Slc28a2 APN 2 122458212 missense probably benign 0.00
IGL02576:Slc28a2 APN 2 122458171 missense probably damaging 0.99
IGL02948:Slc28a2 APN 2 122457977 missense possibly damaging 0.70
IGL03006:Slc28a2 APN 2 122452538 missense possibly damaging 0.65
IGL03061:Slc28a2 APN 2 122454499 missense probably damaging 1.00
R0028:Slc28a2 UTSW 2 122451602 missense probably damaging 1.00
R0240:Slc28a2 UTSW 2 122454527 missense probably benign
R0240:Slc28a2 UTSW 2 122454527 missense probably benign
R0427:Slc28a2 UTSW 2 122458221 missense probably benign 0.02
R0502:Slc28a2 UTSW 2 122458281 critical splice donor site probably null
R0981:Slc28a2 UTSW 2 122450984 missense probably damaging 1.00
R1229:Slc28a2 UTSW 2 122460531 nonsense probably null
R1397:Slc28a2 UTSW 2 122460531 nonsense probably null
R1641:Slc28a2 UTSW 2 122455617 missense probably damaging 1.00
R1713:Slc28a2 UTSW 2 122451013 missense probably damaging 1.00
R1732:Slc28a2 UTSW 2 122449758 splice site probably benign
R1765:Slc28a2 UTSW 2 122460395 intron probably null
R1955:Slc28a2 UTSW 2 122447866 missense probably benign
R1996:Slc28a2 UTSW 2 122455562 missense probably damaging 1.00
R2299:Slc28a2 UTSW 2 122441778 nonsense probably null
R2300:Slc28a2 UTSW 2 122441778 nonsense probably null
R2510:Slc28a2 UTSW 2 122451016 nonsense probably null
R4038:Slc28a2 UTSW 2 122454515 missense probably benign 0.03
R4893:Slc28a2 UTSW 2 122455216 intron probably null
R5011:Slc28a2 UTSW 2 122457890 missense possibly damaging 0.94
R5013:Slc28a2 UTSW 2 122457890 missense possibly damaging 0.94
R5185:Slc28a2 UTSW 2 122458194 missense probably benign 0.04
R7181:Slc28a2 UTSW 2 122451981 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACGTGAAAACAGGACCTCATGG -3'
(R):5'- TTGGACAAGGCAAGTGCAC -3'

Sequencing Primer
(F):5'- CAGGACCTCATGGAGATGGTTG -3'
(R):5'- GGATGATGCATCAATCTGTAAAGCC -3'
Posted On2018-04-02