Incidental Mutation 'R6317:Pex11g'
ID510033
Institutional Source Beutler Lab
Gene Symbol Pex11g
Ensembl Gene ENSMUSG00000069633
Gene Nameperoxisomal biogenesis factor 11 gamma
SynonymsPex11c, 1810049N02Rik, 1810022F11Rik, Pex11gamma
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R6317 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location3457105-3467680 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 3464092 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 23 (D23E)
Ref Sequence ENSEMBL: ENSMUSP00000106710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004686] [ENSMUST00000111081]
Predicted Effect probably damaging
Transcript: ENSMUST00000004686
AA Change: D86E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000004686
Gene: ENSMUSG00000069633
AA Change: D86E

DomainStartEndE-ValueType
Pfam:PEX11 4 230 4.5e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111081
AA Change: D23E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106710
Gene: ENSMUSG00000069633
AA Change: D23E

DomainStartEndE-ValueType
Pfam:PEX11 1 151 4.2e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118194
SMART Domains Protein: ENSMUSP00000113294
Gene: ENSMUSG00000069633

DomainStartEndE-ValueType
Pfam:PEX11 4 144 3.1e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207266
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PEX11 family. This family is reported to regulate the number and size of peroxisomes in evolutionarily distant organisms. The protein encoded by this gene may induce clustering of peroxisomes. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T C 18: 70,468,193 N206S probably damaging Het
Abcf2 A T 5: 24,569,158 Y315* probably null Het
Adck1 T G 12: 88,402,151 V133G probably damaging Het
Aoc2 T C 11: 101,325,466 F125S probably damaging Het
As3mt A G 19: 46,724,971 D319G probably benign Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
Baz1a T C 12: 54,954,800 Q145R possibly damaging Het
BC067074 T A 13: 113,368,268 L1977H probably benign Het
Bhlhe22 A G 3: 18,055,614 E276G probably damaging Het
Cdo1 C A 18: 46,728,037 V36L probably benign Het
Ces1h A G 8: 93,357,418 F388S unknown Het
Col6a5 T A 9: 105,889,067 N1885Y probably damaging Het
Corin A T 5: 72,339,045 C522S probably damaging Het
Csmd1 G T 8: 16,710,642 T159K possibly damaging Het
Cwc27 T A 13: 104,804,261 K197* probably null Het
Cyp20a1 T C 1: 60,352,124 S26P probably damaging Het
Daxx T A 17: 33,911,975 D321E probably damaging Het
Gria2 A C 3: 80,741,004 Y142D possibly damaging Het
Gspt1 T C 16: 11,223,208 probably null Het
Ighv1-80 A T 12: 115,912,645 V17D probably damaging Het
Ints4 T A 7: 97,529,218 L675* probably null Het
Kif13a C T 13: 46,826,757 R173Q probably damaging Het
Map3k2 T C 18: 32,203,033 I91T probably damaging Het
Map3k8 A G 18: 4,348,979 probably null Het
Mcemp1 G A 8: 3,667,284 W101* probably null Het
Mgea5 A T 19: 45,771,680 probably null Het
Naca T C 10: 128,044,124 I1675T probably benign Het
Nol9 T C 4: 152,041,057 F155S probably damaging Het
Obscn C A 11: 59,069,895 D3406Y probably damaging Het
Obsl1 A G 1: 75,489,629 V1485A possibly damaging Het
Olfr151 T C 9: 37,730,429 K185E possibly damaging Het
Otog C A 7: 46,301,215 P337H probably damaging Het
Patl1 T C 19: 11,920,878 L140P probably damaging Het
Pcca G A 14: 122,582,623 V60M probably damaging Het
Phactr2 A T 10: 13,261,882 M172K probably damaging Het
Plce1 G A 19: 38,524,530 W91* probably null Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Podn A G 4: 108,027,160 F44S probably damaging Het
Polr3e A G 7: 120,927,982 D87G possibly damaging Het
Prmt2 T A 10: 76,222,517 I153F probably benign Het
Prpf6 T C 2: 181,631,436 V258A probably benign Het
Ptpn21 G T 12: 98,689,262 A482E probably damaging Het
Qrich1 A T 9: 108,534,292 N339Y probably damaging Het
Rabgap1 T A 2: 37,542,647 V750D possibly damaging Het
Reg3d G A 6: 78,377,445 P58S probably damaging Het
Rp1 A G 1: 4,041,989 L1213P unknown Het
Sema6b A G 17: 56,124,047 L872S probably benign Het
Serpinb7 T C 1: 107,451,706 I281T probably damaging Het
Shank2 T C 7: 144,285,084 V685A possibly damaging Het
Slc28a2 A G 2: 122,454,499 I323V possibly damaging Het
Slc7a6 A T 8: 106,192,467 I228F probably damaging Het
Slc9a9 A G 9: 94,939,459 T300A possibly damaging Het
Spta1 A G 1: 174,241,087 N2151S probably damaging Het
Sult2a1 T A 7: 13,836,020 I96L probably benign Het
Tgm2 T C 2: 158,124,150 D528G probably benign Het
Ubl7 T C 9: 57,911,173 probably null Het
Vcan T A 13: 89,691,597 I983L probably benign Het
Vmn1r172 T C 7: 23,660,317 L209P probably damaging Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Vmn1r3 T C 4: 3,184,993 S105G probably benign Het
Zfp644 A T 5: 106,635,845 H945Q probably damaging Het
Other mutations in Pex11g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02272:Pex11g APN 8 3465898 missense probably benign 0.34
R3947:Pex11g UTSW 8 3465787 missense probably benign 0.21
R4597:Pex11g UTSW 8 3464043 missense probably damaging 1.00
R4610:Pex11g UTSW 8 3465899 missense probably benign 0.03
R4898:Pex11g UTSW 8 3464042 missense probably damaging 1.00
R5576:Pex11g UTSW 8 3465875 missense probably damaging 1.00
R7195:Pex11g UTSW 8 3459237 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAACAGCCATTGGGGACTTCAG -3'
(R):5'- AGCCAGGCCTAGCTCTTTTC -3'

Sequencing Primer
(F):5'- GGCAGATATCACTTACTTGACAGCTC -3'
(R):5'- AGCTCTTTTCTTGCACAGCTGTTAG -3'
Posted On2018-04-02