Incidental Mutation 'R6317:Phactr2'
ID510044
Institutional Source Beutler Lab
Gene Symbol Phactr2
Ensembl Gene ENSMUSG00000062866
Gene Namephosphatase and actin regulator 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R6317 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location13207717-13474412 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13261882 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 172 (M172K)
Ref Sequence ENSEMBL: ENSMUSP00000101184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079698] [ENSMUST00000105543] [ENSMUST00000105545] [ENSMUST00000105546]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079698
AA Change: M102K

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000078637
Gene: ENSMUSG00000062866
AA Change: M102K

DomainStartEndE-ValueType
low complexity region 39 54 N/A INTRINSIC
RPEL 60 85 7.44e-6 SMART
low complexity region 154 179 N/A INTRINSIC
low complexity region 208 218 N/A INTRINSIC
low complexity region 250 270 N/A INTRINSIC
low complexity region 378 388 N/A INTRINSIC
RPEL 403 428 5.81e-8 SMART
RPEL 441 466 1.36e-8 SMART
RPEL 479 504 1.64e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105543
AA Change: M113K

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101182
Gene: ENSMUSG00000062866
AA Change: M113K

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
RPEL 71 96 7.44e-6 SMART
low complexity region 165 190 N/A INTRINSIC
low complexity region 219 229 N/A INTRINSIC
low complexity region 261 281 N/A INTRINSIC
low complexity region 389 399 N/A INTRINSIC
RPEL 414 439 5.81e-8 SMART
RPEL 452 477 1.36e-8 SMART
RPEL 490 515 1.64e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105545
AA Change: M172K

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101184
Gene: ENSMUSG00000062866
AA Change: M172K

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
RPEL 71 96 7.44e-6 SMART
low complexity region 157 182 N/A INTRINSIC
low complexity region 211 221 N/A INTRINSIC
low complexity region 253 273 N/A INTRINSIC
low complexity region 381 391 N/A INTRINSIC
RPEL 406 431 5.81e-8 SMART
RPEL 444 469 1.36e-8 SMART
RPEL 482 507 1.64e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105546
AA Change: M102K

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101185
Gene: ENSMUSG00000062866
AA Change: M102K

DomainStartEndE-ValueType
low complexity region 39 54 N/A INTRINSIC
RPEL 60 85 7.44e-6 SMART
low complexity region 133 144 N/A INTRINSIC
low complexity region 149 184 N/A INTRINSIC
low complexity region 199 213 N/A INTRINSIC
low complexity region 226 251 N/A INTRINSIC
low complexity region 280 290 N/A INTRINSIC
low complexity region 322 342 N/A INTRINSIC
low complexity region 450 460 N/A INTRINSIC
RPEL 475 500 5.81e-8 SMART
RPEL 513 538 1.36e-8 SMART
RPEL 551 576 1.64e-7 SMART
Meta Mutation Damage Score 0.1 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T C 18: 70,468,193 N206S probably damaging Het
Abcf2 A T 5: 24,569,158 Y315* probably null Het
Adck1 T G 12: 88,402,151 V133G probably damaging Het
Aoc2 T C 11: 101,325,466 F125S probably damaging Het
As3mt A G 19: 46,724,971 D319G probably benign Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
Baz1a T C 12: 54,954,800 Q145R possibly damaging Het
BC067074 T A 13: 113,368,268 L1977H probably benign Het
Bhlhe22 A G 3: 18,055,614 E276G probably damaging Het
Cdo1 C A 18: 46,728,037 V36L probably benign Het
Ces1h A G 8: 93,357,418 F388S unknown Het
Col6a5 T A 9: 105,889,067 N1885Y probably damaging Het
Corin A T 5: 72,339,045 C522S probably damaging Het
Csmd1 G T 8: 16,710,642 T159K possibly damaging Het
Cwc27 T A 13: 104,804,261 K197* probably null Het
Cyp20a1 T C 1: 60,352,124 S26P probably damaging Het
Daxx T A 17: 33,911,975 D321E probably damaging Het
Gria2 A C 3: 80,741,004 Y142D possibly damaging Het
Gspt1 T C 16: 11,223,208 probably null Het
Ighv1-80 A T 12: 115,912,645 V17D probably damaging Het
Ints4 T A 7: 97,529,218 L675* probably null Het
Kif13a C T 13: 46,826,757 R173Q probably damaging Het
Map3k2 T C 18: 32,203,033 I91T probably damaging Het
Map3k8 A G 18: 4,348,979 probably null Het
Mcemp1 G A 8: 3,667,284 W101* probably null Het
Mgea5 A T 19: 45,771,680 probably null Het
Naca T C 10: 128,044,124 I1675T probably benign Het
Nol9 T C 4: 152,041,057 F155S probably damaging Het
Obscn C A 11: 59,069,895 D3406Y probably damaging Het
Obsl1 A G 1: 75,489,629 V1485A possibly damaging Het
Olfr151 T C 9: 37,730,429 K185E possibly damaging Het
Otog C A 7: 46,301,215 P337H probably damaging Het
Patl1 T C 19: 11,920,878 L140P probably damaging Het
Pcca G A 14: 122,582,623 V60M probably damaging Het
Pex11g G T 8: 3,464,092 D23E probably damaging Het
Plce1 G A 19: 38,524,530 W91* probably null Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Podn A G 4: 108,027,160 F44S probably damaging Het
Polr3e A G 7: 120,927,982 D87G possibly damaging Het
Prmt2 T A 10: 76,222,517 I153F probably benign Het
Prpf6 T C 2: 181,631,436 V258A probably benign Het
Ptpn21 G T 12: 98,689,262 A482E probably damaging Het
Qrich1 A T 9: 108,534,292 N339Y probably damaging Het
Rabgap1 T A 2: 37,542,647 V750D possibly damaging Het
Reg3d G A 6: 78,377,445 P58S probably damaging Het
Rp1 A G 1: 4,041,989 L1213P unknown Het
Sema6b A G 17: 56,124,047 L872S probably benign Het
Serpinb7 T C 1: 107,451,706 I281T probably damaging Het
Shank2 T C 7: 144,285,084 V685A possibly damaging Het
Slc28a2 A G 2: 122,454,499 I323V possibly damaging Het
Slc7a6 A T 8: 106,192,467 I228F probably damaging Het
Slc9a9 A G 9: 94,939,459 T300A possibly damaging Het
Spta1 A G 1: 174,241,087 N2151S probably damaging Het
Sult2a1 T A 7: 13,836,020 I96L probably benign Het
Tgm2 T C 2: 158,124,150 D528G probably benign Het
Ubl7 T C 9: 57,911,173 probably null Het
Vcan T A 13: 89,691,597 I983L probably benign Het
Vmn1r172 T C 7: 23,660,317 L209P probably damaging Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Vmn1r3 T C 4: 3,184,993 S105G probably benign Het
Zfp644 A T 5: 106,635,845 H945Q probably damaging Het
Other mutations in Phactr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Phactr2 APN 10 13245535 missense probably damaging 1.00
IGL01844:Phactr2 APN 10 13253437 missense probably benign 0.05
IGL01893:Phactr2 APN 10 13247188 missense probably benign 0.38
IGL02458:Phactr2 APN 10 13261828 missense probably damaging 1.00
IGL02612:Phactr2 APN 10 13245423 missense probably damaging 0.99
IGL02620:Phactr2 APN 10 13291888 missense probably damaging 1.00
IGL03064:Phactr2 APN 10 13388713 utr 5 prime probably benign
IGL03493:Phactr2 APN 10 13257669 missense probably benign 0.02
R0973:Phactr2 UTSW 10 13247139 missense possibly damaging 0.88
R0973:Phactr2 UTSW 10 13247139 missense possibly damaging 0.88
R0974:Phactr2 UTSW 10 13247139 missense possibly damaging 0.88
R1480:Phactr2 UTSW 10 13253792 missense possibly damaging 0.74
R3115:Phactr2 UTSW 10 13261901 nonsense probably null
R3116:Phactr2 UTSW 10 13261901 nonsense probably null
R3713:Phactr2 UTSW 10 13388732 start gained probably benign
R4367:Phactr2 UTSW 10 13253820 missense probably damaging 1.00
R4368:Phactr2 UTSW 10 13253820 missense probably damaging 1.00
R4371:Phactr2 UTSW 10 13253820 missense probably damaging 1.00
R5344:Phactr2 UTSW 10 13253616 missense possibly damaging 0.76
R5491:Phactr2 UTSW 10 13261846 missense possibly damaging 0.91
R5617:Phactr2 UTSW 10 13474065 missense possibly damaging 0.60
R5656:Phactr2 UTSW 10 13388703 missense probably benign 0.34
R5895:Phactr2 UTSW 10 13245517 missense probably damaging 1.00
R6051:Phactr2 UTSW 10 13261811 unclassified probably null 0.00
R7048:Phactr2 UTSW 10 13245424 missense probably benign 0.28
R7101:Phactr2 UTSW 10 13247178 missense probably benign 0.00
R7221:Phactr2 UTSW 10 13247039 missense possibly damaging 0.58
X0026:Phactr2 UTSW 10 13257634 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTTGGATCTCAAAGTTGGGC -3'
(R):5'- TGCTTTCCTCAAGACCAAGAATTG -3'

Sequencing Primer
(F):5'- ATCTCAAAGTTGGGCTGTGCTAC -3'
(R):5'- AGACCAAGAATTGTATGCCTCTTTCC -3'
Posted On2018-04-02