Incidental Mutation 'R6317:Pcca'
ID510057
Institutional Source Beutler Lab
Gene Symbol Pcca
Ensembl Gene ENSMUSG00000041650
Gene Namepropionyl-Coenzyme A carboxylase, alpha polypeptide
SynonymsC79630
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6317 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location122534324-122891100 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 122582623 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 60 (V60M)
Ref Sequence ENSEMBL: ENSMUSP00000120027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038374] [ENSMUST00000135578] [ENSMUST00000154206]
Predicted Effect probably damaging
Transcript: ENSMUST00000038374
AA Change: V99M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038763
Gene: ENSMUSG00000041650
AA Change: V99M

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 58 167 2.1e-48 PFAM
Pfam:ATP-grasp_4 169 351 3.8e-15 PFAM
Pfam:RimK 170 372 5.6e-7 PFAM
Pfam:CPSase_L_D2 172 381 2.8e-87 PFAM
Pfam:ATP-grasp 181 351 9.8e-10 PFAM
Pfam:Dala_Dala_lig_C 192 349 7.7e-12 PFAM
Biotin_carb_C 393 501 4.27e-46 SMART
Pfam:Biotin_lipoyl 656 723 1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135578
SMART Domains Protein: ENSMUSP00000123422
Gene: ENSMUSG00000041650

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 58 102 6.1e-15 PFAM
Pfam:CPSase_L_D2 116 163 9.9e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148172
Predicted Effect probably damaging
Transcript: ENSMUST00000154206
AA Change: V60M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120027
Gene: ENSMUSG00000041650
AA Change: V60M

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 43 128 5.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177312
Meta Mutation Damage Score 0.322 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the alpha subunit of the heterodimeric mitochondrial enzyme Propionyl-CoA carboxylase. PCCA encodes the biotin-binding region of this enzyme. Mutations in either PCCA or PCCB (encoding the beta subunit) lead to an enzyme deficiency resulting in propionic acidemia. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice die 24-36 hours after birth due to accelerated ketoacidosis. Death is preceded by reduced milk intake, poor movement, dehydration, accumulation of propionyl-CoA, ketonuria, increased fat deposition and glycogen consumption in liver, and enlarged kidney collecting ducts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T C 18: 70,468,193 N206S probably damaging Het
Abcf2 A T 5: 24,569,158 Y315* probably null Het
Adck1 T G 12: 88,402,151 V133G probably damaging Het
Aoc2 T C 11: 101,325,466 F125S probably damaging Het
As3mt A G 19: 46,724,971 D319G probably benign Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
Baz1a T C 12: 54,954,800 Q145R possibly damaging Het
BC067074 T A 13: 113,368,268 L1977H probably benign Het
Bhlhe22 A G 3: 18,055,614 E276G probably damaging Het
Cdo1 C A 18: 46,728,037 V36L probably benign Het
Ces1h A G 8: 93,357,418 F388S unknown Het
Col6a5 T A 9: 105,889,067 N1885Y probably damaging Het
Corin A T 5: 72,339,045 C522S probably damaging Het
Csmd1 G T 8: 16,710,642 T159K possibly damaging Het
Cwc27 T A 13: 104,804,261 K197* probably null Het
Cyp20a1 T C 1: 60,352,124 S26P probably damaging Het
Daxx T A 17: 33,911,975 D321E probably damaging Het
Gria2 A C 3: 80,741,004 Y142D possibly damaging Het
Gspt1 T C 16: 11,223,208 probably null Het
Ighv1-80 A T 12: 115,912,645 V17D probably damaging Het
Ints4 T A 7: 97,529,218 L675* probably null Het
Kif13a C T 13: 46,826,757 R173Q probably damaging Het
Map3k2 T C 18: 32,203,033 I91T probably damaging Het
Map3k8 A G 18: 4,348,979 probably null Het
Mcemp1 G A 8: 3,667,284 W101* probably null Het
Mgea5 A T 19: 45,771,680 probably null Het
Naca T C 10: 128,044,124 I1675T probably benign Het
Nol9 T C 4: 152,041,057 F155S probably damaging Het
Obscn C A 11: 59,069,895 D3406Y probably damaging Het
Obsl1 A G 1: 75,489,629 V1485A possibly damaging Het
Olfr151 T C 9: 37,730,429 K185E possibly damaging Het
Otog C A 7: 46,301,215 P337H probably damaging Het
Patl1 T C 19: 11,920,878 L140P probably damaging Het
Pex11g G T 8: 3,464,092 D23E probably damaging Het
Phactr2 A T 10: 13,261,882 M172K probably damaging Het
Plce1 G A 19: 38,524,530 W91* probably null Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Podn A G 4: 108,027,160 F44S probably damaging Het
Polr3e A G 7: 120,927,982 D87G possibly damaging Het
Prmt2 T A 10: 76,222,517 I153F probably benign Het
Prpf6 T C 2: 181,631,436 V258A probably benign Het
Ptpn21 G T 12: 98,689,262 A482E probably damaging Het
Qrich1 A T 9: 108,534,292 N339Y probably damaging Het
Rabgap1 T A 2: 37,542,647 V750D possibly damaging Het
Reg3d G A 6: 78,377,445 P58S probably damaging Het
Rp1 A G 1: 4,041,989 L1213P unknown Het
Sema6b A G 17: 56,124,047 L872S probably benign Het
Serpinb7 T C 1: 107,451,706 I281T probably damaging Het
Shank2 T C 7: 144,285,084 V685A possibly damaging Het
Slc28a2 A G 2: 122,454,499 I323V possibly damaging Het
Slc7a6 A T 8: 106,192,467 I228F probably damaging Het
Slc9a9 A G 9: 94,939,459 T300A possibly damaging Het
Spta1 A G 1: 174,241,087 N2151S probably damaging Het
Sult2a1 T A 7: 13,836,020 I96L probably benign Het
Tgm2 T C 2: 158,124,150 D528G probably benign Het
Ubl7 T C 9: 57,911,173 probably null Het
Vcan T A 13: 89,691,597 I983L probably benign Het
Vmn1r172 T C 7: 23,660,317 L209P probably damaging Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Vmn1r3 T C 4: 3,184,993 S105G probably benign Het
Zfp644 A T 5: 106,635,845 H945Q probably damaging Het
Other mutations in Pcca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Pcca APN 14 122582629 missense probably benign 0.22
IGL00906:Pcca APN 14 122690133 missense probably benign 0.34
IGL00975:Pcca APN 14 122876900 missense probably damaging 1.00
IGL01329:Pcca APN 14 122690133 missense possibly damaging 0.50
IGL01353:Pcca APN 14 122582617 missense probably damaging 0.98
IGL01672:Pcca APN 14 122690145 missense probably benign 0.02
IGL02621:Pcca APN 14 122684979 missense probably damaging 0.99
IGL02695:Pcca APN 14 122582738 splice site probably benign
IGL02749:Pcca APN 14 122534388 missense probably benign 0.00
IGL02971:Pcca APN 14 122889533 missense probably damaging 0.96
IGL03290:Pcca APN 14 122585106 missense possibly damaging 0.52
IGL03052:Pcca UTSW 14 122887101 missense probably benign
PIT4812001:Pcca UTSW 14 122790382 missense probably benign 0.00
R0549:Pcca UTSW 14 122638377 splice site probably benign
R0866:Pcca UTSW 14 122889545 missense possibly damaging 0.95
R1498:Pcca UTSW 14 122616818 missense probably damaging 1.00
R1749:Pcca UTSW 14 122701130 missense probably damaging 0.97
R2002:Pcca UTSW 14 122887065 missense probably benign 0.00
R2020:Pcca UTSW 14 122813222 missense possibly damaging 0.64
R2086:Pcca UTSW 14 122686115 missense probably damaging 0.99
R3780:Pcca UTSW 14 122684885 missense probably damaging 1.00
R5023:Pcca UTSW 14 122790398 missense probably damaging 1.00
R5643:Pcca UTSW 14 122887069 missense probably damaging 1.00
R5644:Pcca UTSW 14 122887069 missense probably damaging 1.00
R5943:Pcca UTSW 14 122658776 missense probably damaging 0.99
R5966:Pcca UTSW 14 122668586 missense probably damaging 0.96
R6295:Pcca UTSW 14 122658775 missense probably benign 0.10
R6319:Pcca UTSW 14 122582623 missense probably damaging 1.00
R6361:Pcca UTSW 14 122638382 missense probably benign 0.07
R6989:Pcca UTSW 14 122650288 missense probably damaging 1.00
R7243:Pcca UTSW 14 122876774 missense probably benign
X0026:Pcca UTSW 14 122616791 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- TGAAGTCACGGGTGATGCTG -3'
(R):5'- ACTGCAACAGCGTTTTCAATC -3'

Sequencing Primer
(F):5'- GATGCTGACCCCGAACATTTTTG -3'
(R):5'- GCAACAGCGTTTTCAATCATTCTTC -3'
Posted On2018-04-02