Incidental Mutation 'R6317:Plce1'
ID510065
Institutional Source Beutler Lab
Gene Symbol Plce1
Ensembl Gene ENSMUSG00000024998
Gene Namephospholipase C, epsilon 1
Synonyms4933403A21Rik, PLCepsilon
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.394) question?
Stock #R6317 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location38481109-38785030 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 38524530 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 91 (W91*)
Ref Sequence ENSEMBL: ENSMUSP00000138360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169713] [ENSMUST00000182267] [ENSMUST00000182481]
Predicted Effect probably null
Transcript: ENSMUST00000169713
AA Change: W91*
SMART Domains Protein: ENSMUSP00000130604
Gene: ENSMUSG00000024998
AA Change: W91*

DomainStartEndE-ValueType
low complexity region 471 489 N/A INTRINSIC
RasGEF 525 828 8.06e-9 SMART
low complexity region 1162 1172 N/A INTRINSIC
Pfam:EF-hand_like 1305 1369 7.6e-11 PFAM
PLCXc 1373 1521 1.05e-81 SMART
low complexity region 1561 1575 N/A INTRINSIC
SCOP:d1qasa3 1634 1662 1e-3 SMART
low complexity region 1666 1680 N/A INTRINSIC
PLCYc 1710 1826 4.28e-46 SMART
C2 1850 1948 3.7e-10 SMART
PDB:2BYE|A 1986 2094 6e-47 PDB
RA 2115 2218 1.12e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181994
Predicted Effect probably null
Transcript: ENSMUST00000182267
AA Change: W91*
SMART Domains Protein: ENSMUSP00000138330
Gene: ENSMUSG00000024998
AA Change: W91*

DomainStartEndE-ValueType
low complexity region 471 489 N/A INTRINSIC
RasGEF 525 828 8.06e-9 SMART
low complexity region 1162 1172 N/A INTRINSIC
Pfam:EF-hand_like 1305 1369 5.9e-11 PFAM
PLCXc 1373 1521 1.05e-81 SMART
low complexity region 1552 1581 N/A INTRINSIC
SCOP:d1qasa3 1648 1676 1e-3 SMART
low complexity region 1680 1694 N/A INTRINSIC
PLCYc 1724 1840 4.28e-46 SMART
C2 1864 1962 3.7e-10 SMART
PDB:2BYE|A 2000 2108 6e-47 PDB
RA 2129 2232 1.12e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000182481
AA Change: W91*
SMART Domains Protein: ENSMUSP00000138360
Gene: ENSMUSG00000024998
AA Change: W91*

DomainStartEndE-ValueType
low complexity region 471 489 N/A INTRINSIC
RasGEF 525 828 8.06e-9 SMART
low complexity region 1162 1172 N/A INTRINSIC
Pfam:EF-hand_like 1305 1369 8e-11 PFAM
PLCXc 1373 1521 1.05e-81 SMART
low complexity region 1561 1575 N/A INTRINSIC
SCOP:d1qasa3 1634 1662 1e-3 SMART
low complexity region 1666 1680 N/A INTRINSIC
PLCYc 1710 1826 4.28e-46 SMART
C2 1850 1948 3.7e-10 SMART
PDB:2BYE|A 1986 2094 6e-47 PDB
RA 2115 2218 1.12e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phospholipase enzyme that catalyzes the hydrolysis of phosphatidylinositol-4,5-bisphosphate to generate two second messengers: inositol 1,4,5-triphosphate (IP3) and diacylglycerol (DAG). These second messengers subsequently regulate various processes affecting cell growth, differentiation, and gene expression. This enzyme is regulated by small monomeric GTPases of the Ras and Rho families and by heterotrimeric G proteins. In addition to its phospholipase C catalytic activity, this enzyme has an N-terminal domain with guanine nucleotide exchange (GEF) activity. Mutations in this gene cause early-onset nephrotic syndrome; characterized by proteinuria, edema, and diffuse mesangial sclerosis or focal and segmental glomerulosclerosis. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous mutation of this gene results in a congenital semilunar valvulogenesis defect which causes regurgitation and stenosis, and decreased incidence of induced skin tumors. Another mutant exhibits decreased cardiac contraction and increased hypertrophy in response to chronic stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T C 18: 70,468,193 N206S probably damaging Het
Abcf2 A T 5: 24,569,158 Y315* probably null Het
Adck1 T G 12: 88,402,151 V133G probably damaging Het
Aoc2 T C 11: 101,325,466 F125S probably damaging Het
As3mt A G 19: 46,724,971 D319G probably benign Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
Baz1a T C 12: 54,954,800 Q145R possibly damaging Het
BC067074 T A 13: 113,368,268 L1977H probably benign Het
Bhlhe22 A G 3: 18,055,614 E276G probably damaging Het
Cdo1 C A 18: 46,728,037 V36L probably benign Het
Ces1h A G 8: 93,357,418 F388S unknown Het
Col6a5 T A 9: 105,889,067 N1885Y probably damaging Het
Corin A T 5: 72,339,045 C522S probably damaging Het
Csmd1 G T 8: 16,710,642 T159K possibly damaging Het
Cwc27 T A 13: 104,804,261 K197* probably null Het
Cyp20a1 T C 1: 60,352,124 S26P probably damaging Het
Daxx T A 17: 33,911,975 D321E probably damaging Het
Gria2 A C 3: 80,741,004 Y142D possibly damaging Het
Gspt1 T C 16: 11,223,208 probably null Het
Ighv1-80 A T 12: 115,912,645 V17D probably damaging Het
Ints4 T A 7: 97,529,218 L675* probably null Het
Kif13a C T 13: 46,826,757 R173Q probably damaging Het
Map3k2 T C 18: 32,203,033 I91T probably damaging Het
Map3k8 A G 18: 4,348,979 probably null Het
Mcemp1 G A 8: 3,667,284 W101* probably null Het
Mgea5 A T 19: 45,771,680 probably null Het
Naca T C 10: 128,044,124 I1675T probably benign Het
Nol9 T C 4: 152,041,057 F155S probably damaging Het
Obscn C A 11: 59,069,895 D3406Y probably damaging Het
Obsl1 A G 1: 75,489,629 V1485A possibly damaging Het
Olfr151 T C 9: 37,730,429 K185E possibly damaging Het
Otog C A 7: 46,301,215 P337H probably damaging Het
Patl1 T C 19: 11,920,878 L140P probably damaging Het
Pcca G A 14: 122,582,623 V60M probably damaging Het
Pex11g G T 8: 3,464,092 D23E probably damaging Het
Phactr2 A T 10: 13,261,882 M172K probably damaging Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Podn A G 4: 108,027,160 F44S probably damaging Het
Polr3e A G 7: 120,927,982 D87G possibly damaging Het
Prmt2 T A 10: 76,222,517 I153F probably benign Het
Prpf6 T C 2: 181,631,436 V258A probably benign Het
Ptpn21 G T 12: 98,689,262 A482E probably damaging Het
Qrich1 A T 9: 108,534,292 N339Y probably damaging Het
Rabgap1 T A 2: 37,542,647 V750D possibly damaging Het
Reg3d G A 6: 78,377,445 P58S probably damaging Het
Rp1 A G 1: 4,041,989 L1213P unknown Het
Sema6b A G 17: 56,124,047 L872S probably benign Het
Serpinb7 T C 1: 107,451,706 I281T probably damaging Het
Shank2 T C 7: 144,285,084 V685A possibly damaging Het
Slc28a2 A G 2: 122,454,499 I323V possibly damaging Het
Slc7a6 A T 8: 106,192,467 I228F probably damaging Het
Slc9a9 A G 9: 94,939,459 T300A possibly damaging Het
Spta1 A G 1: 174,241,087 N2151S probably damaging Het
Sult2a1 T A 7: 13,836,020 I96L probably benign Het
Tgm2 T C 2: 158,124,150 D528G probably benign Het
Ubl7 T C 9: 57,911,173 probably null Het
Vcan T A 13: 89,691,597 I983L probably benign Het
Vmn1r172 T C 7: 23,660,317 L209P probably damaging Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Vmn1r3 T C 4: 3,184,993 S105G probably benign Het
Zfp644 A T 5: 106,635,845 H945Q probably damaging Het
Other mutations in Plce1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Plce1 APN 19 38745788 missense probably damaging 0.99
IGL00336:Plce1 APN 19 38651906 missense probably damaging 1.00
IGL00430:Plce1 APN 19 38725017 missense probably damaging 1.00
IGL00466:Plce1 APN 19 38721029 missense probably damaging 0.99
IGL00477:Plce1 APN 19 38525132 missense probably benign 0.39
IGL00839:Plce1 APN 19 38698562 missense probably damaging 1.00
IGL01292:Plce1 APN 19 38651785 splice site probably benign
IGL01665:Plce1 APN 19 38524887 missense probably benign 0.01
IGL01826:Plce1 APN 19 38739238 splice site probably benign
IGL01833:Plce1 APN 19 38720981 missense probably damaging 1.00
IGL02201:Plce1 APN 19 38769446 splice site probably benign
IGL02276:Plce1 APN 19 38524757 missense probably benign 0.05
IGL02477:Plce1 APN 19 38719553 splice site probably benign
IGL02746:Plce1 APN 19 38698472 missense probably damaging 1.00
angel_food UTSW 19 38727013 splice site probably benign
heavenly UTSW 19 38777989 missense probably damaging 1.00
R0058:Plce1 UTSW 19 38525184 missense possibly damaging 0.90
R0058:Plce1 UTSW 19 38525184 missense possibly damaging 0.90
R0064:Plce1 UTSW 19 38780784 critical splice donor site probably null
R0116:Plce1 UTSW 19 38721821 missense probably benign
R0138:Plce1 UTSW 19 38524419 missense possibly damaging 0.49
R0240:Plce1 UTSW 19 38728886 missense probably damaging 0.99
R0240:Plce1 UTSW 19 38728886 missense probably damaging 0.99
R0504:Plce1 UTSW 19 38778021 splice site probably benign
R0506:Plce1 UTSW 19 38760138 missense probably benign 0.04
R0578:Plce1 UTSW 19 38777939 missense probably damaging 1.00
R0645:Plce1 UTSW 19 38777989 missense probably damaging 1.00
R0730:Plce1 UTSW 19 38716691 missense probably damaging 0.98
R0920:Plce1 UTSW 19 38736521 missense probably damaging 1.00
R1223:Plce1 UTSW 19 38702013 missense probably damaging 1.00
R1223:Plce1 UTSW 19 38767226 missense probably damaging 1.00
R1484:Plce1 UTSW 19 38705339 nonsense probably null
R1488:Plce1 UTSW 19 38716803 missense possibly damaging 0.92
R1598:Plce1 UTSW 19 38720996 missense probably damaging 1.00
R1624:Plce1 UTSW 19 38724775 missense probably damaging 1.00
R1732:Plce1 UTSW 19 38716838 missense possibly damaging 0.56
R1778:Plce1 UTSW 19 38780790 splice site probably benign
R1797:Plce1 UTSW 19 38758948 critical splice donor site probably null
R1872:Plce1 UTSW 19 38760077 missense probably damaging 1.00
R1876:Plce1 UTSW 19 38780623 missense probably damaging 1.00
R1991:Plce1 UTSW 19 38777924 missense probably damaging 1.00
R2080:Plce1 UTSW 19 38727013 splice site probably benign
R2103:Plce1 UTSW 19 38777924 missense probably damaging 1.00
R2376:Plce1 UTSW 19 38777986 missense probably benign 0.02
R2471:Plce1 UTSW 19 38779926 missense probably damaging 1.00
R2511:Plce1 UTSW 19 38760054 missense probably damaging 1.00
R2842:Plce1 UTSW 19 38524283 missense probably damaging 1.00
R3037:Plce1 UTSW 19 38777884 missense probably damaging 0.98
R3104:Plce1 UTSW 19 38620519 missense probably benign 0.00
R3700:Plce1 UTSW 19 38705337 missense probably damaging 1.00
R3750:Plce1 UTSW 19 38777899 missense probably benign
R3753:Plce1 UTSW 19 38651834 missense probably benign 0.09
R4027:Plce1 UTSW 19 38524265 missense probably damaging 1.00
R4057:Plce1 UTSW 19 38760119 missense probably damaging 1.00
R4376:Plce1 UTSW 19 38705447 critical splice donor site probably null
R4433:Plce1 UTSW 19 38767301 missense probably damaging 1.00
R4520:Plce1 UTSW 19 38524319 missense possibly damaging 0.46
R4521:Plce1 UTSW 19 38524319 missense possibly damaging 0.46
R4522:Plce1 UTSW 19 38524319 missense possibly damaging 0.46
R4524:Plce1 UTSW 19 38524319 missense possibly damaging 0.46
R4650:Plce1 UTSW 19 38524644 missense probably benign 0.30
R4673:Plce1 UTSW 19 38749396 missense possibly damaging 0.51
R4701:Plce1 UTSW 19 38725007 missense probably benign 0.33
R4828:Plce1 UTSW 19 38769499 missense probably damaging 1.00
R5103:Plce1 UTSW 19 38767215 missense probably damaging 1.00
R5112:Plce1 UTSW 19 38651833 missense probably benign 0.00
R5236:Plce1 UTSW 19 38770347 missense probably benign 0.11
R5268:Plce1 UTSW 19 38758835 missense possibly damaging 0.71
R5288:Plce1 UTSW 19 38760091 missense probably damaging 1.00
R5384:Plce1 UTSW 19 38760091 missense probably damaging 1.00
R5386:Plce1 UTSW 19 38760091 missense probably damaging 1.00
R5448:Plce1 UTSW 19 38779917 missense probably damaging 1.00
R5452:Plce1 UTSW 19 38620482 missense probably benign 0.01
R6004:Plce1 UTSW 19 38721871 missense probably damaging 1.00
R6062:Plce1 UTSW 19 38524751 missense probably benign
R6147:Plce1 UTSW 19 38702037 missense probably damaging 1.00
R6247:Plce1 UTSW 19 38745845 missense probably damaging 1.00
R6278:Plce1 UTSW 19 38725051 splice site probably null
R6306:Plce1 UTSW 19 38769465 missense probably damaging 1.00
R6437:Plce1 UTSW 19 38525132 missense probably benign 0.39
R6522:Plce1 UTSW 19 38748521 unclassified probably null
R7034:Plce1 UTSW 19 38739357 missense probably damaging 1.00
R7036:Plce1 UTSW 19 38739357 missense probably damaging 1.00
R7037:Plce1 UTSW 19 38702017 missense probably damaging 1.00
R7069:Plce1 UTSW 19 38758940 missense probably damaging 1.00
R7180:Plce1 UTSW 19 38779785 missense probably damaging 1.00
R7189:Plce1 UTSW 19 38760137 missense probably damaging 0.97
R7227:Plce1 UTSW 19 38726902 missense probably benign 0.00
R7253:Plce1 UTSW 19 38698508 missense probably damaging 1.00
R7287:Plce1 UTSW 19 38701903 missense probably benign 0.02
X0022:Plce1 UTSW 19 38726999 missense probably damaging 1.00
X0065:Plce1 UTSW 19 38777914 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TGACTCAAAGGAAAGTGGCTTC -3'
(R):5'- ACCTTCCTTTCCAGGGGAGAAG -3'

Sequencing Primer
(F):5'- TGTAAAGGTCTCAGATGCGG -3'
(R):5'- TCCTTTCCAGGGGAGAAGGAATTC -3'
Posted On2018-04-02