Incidental Mutation 'R6320:Zbtb17'
ID510082
Institutional Source Beutler Lab
Gene Symbol Zbtb17
Ensembl Gene ENSMUSG00000006215
Gene Namezinc finger and BTB domain containing 17
SynonymsmZ13, Zfp100, Miz1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6320 (G1)
Quality Score171.009
Status Validated
Chromosome4
Chromosomal Location141444654-141467930 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 141463383 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 171 (G171S)
Ref Sequence ENSEMBL: ENSMUSP00000006377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006377] [ENSMUST00000078886] [ENSMUST00000105786]
Predicted Effect probably benign
Transcript: ENSMUST00000006377
AA Change: G171S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000006377
Gene: ENSMUSG00000006215
AA Change: G171S

DomainStartEndE-ValueType
BTB 24 116 1.38e-27 SMART
low complexity region 203 222 N/A INTRINSIC
ZnF_C2H2 297 319 6.42e-4 SMART
ZnF_C2H2 325 347 3.11e-2 SMART
ZnF_C2H2 353 375 2.49e-1 SMART
ZnF_C2H2 381 403 8.47e-4 SMART
ZnF_C2H2 409 431 8.47e-4 SMART
ZnF_C2H2 437 459 1.22e-4 SMART
ZnF_C2H2 465 487 4.94e-5 SMART
ZnF_C2H2 493 515 3.26e-5 SMART
ZnF_C2H2 521 543 7.26e-3 SMART
ZnF_C2H2 549 571 4.79e-3 SMART
ZnF_C2H2 577 599 1.58e-3 SMART
ZnF_C2H2 605 628 2.57e-3 SMART
low complexity region 654 674 N/A INTRINSIC
ZnF_C2H2 708 730 4.4e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078886
SMART Domains Protein: ENSMUSP00000077925
Gene: ENSMUSG00000040761

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 617 632 N/A INTRINSIC
low complexity region 669 691 N/A INTRINSIC
low complexity region 695 720 N/A INTRINSIC
low complexity region 749 773 N/A INTRINSIC
coiled coil region 800 825 N/A INTRINSIC
low complexity region 830 841 N/A INTRINSIC
internal_repeat_2 844 954 6.27e-5 PROSPERO
coiled coil region 1494 1522 N/A INTRINSIC
low complexity region 1587 1627 N/A INTRINSIC
low complexity region 1635 1641 N/A INTRINSIC
low complexity region 1642 1671 N/A INTRINSIC
low complexity region 1747 1758 N/A INTRINSIC
low complexity region 1810 1823 N/A INTRINSIC
low complexity region 1888 1903 N/A INTRINSIC
low complexity region 1940 1955 N/A INTRINSIC
low complexity region 2003 2012 N/A INTRINSIC
internal_repeat_2 2015 2115 6.27e-5 PROSPERO
low complexity region 2127 2147 N/A INTRINSIC
low complexity region 2169 2191 N/A INTRINSIC
low complexity region 2207 2219 N/A INTRINSIC
low complexity region 2304 2323 N/A INTRINSIC
low complexity region 2332 2371 N/A INTRINSIC
low complexity region 2396 2413 N/A INTRINSIC
low complexity region 2518 2533 N/A INTRINSIC
low complexity region 2545 2555 N/A INTRINSIC
low complexity region 2696 2722 N/A INTRINSIC
low complexity region 2931 2942 N/A INTRINSIC
low complexity region 2994 3006 N/A INTRINSIC
low complexity region 3192 3212 N/A INTRINSIC
low complexity region 3299 3337 N/A INTRINSIC
Pfam:SPOC 3465 3586 2.7e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105786
SMART Domains Protein: ENSMUSP00000101412
Gene: ENSMUSG00000040761

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 692 714 N/A INTRINSIC
low complexity region 718 743 N/A INTRINSIC
low complexity region 772 796 N/A INTRINSIC
coiled coil region 823 848 N/A INTRINSIC
low complexity region 853 864 N/A INTRINSIC
internal_repeat_2 867 977 8.58e-5 PROSPERO
coiled coil region 1517 1545 N/A INTRINSIC
low complexity region 1610 1650 N/A INTRINSIC
low complexity region 1658 1664 N/A INTRINSIC
low complexity region 1665 1694 N/A INTRINSIC
low complexity region 1770 1781 N/A INTRINSIC
low complexity region 1833 1846 N/A INTRINSIC
low complexity region 1911 1926 N/A INTRINSIC
low complexity region 1963 1978 N/A INTRINSIC
low complexity region 2026 2035 N/A INTRINSIC
internal_repeat_2 2038 2138 8.58e-5 PROSPERO
low complexity region 2150 2170 N/A INTRINSIC
low complexity region 2192 2214 N/A INTRINSIC
low complexity region 2230 2242 N/A INTRINSIC
low complexity region 2327 2346 N/A INTRINSIC
low complexity region 2355 2394 N/A INTRINSIC
low complexity region 2419 2436 N/A INTRINSIC
low complexity region 2541 2556 N/A INTRINSIC
low complexity region 2568 2578 N/A INTRINSIC
low complexity region 2719 2745 N/A INTRINSIC
low complexity region 2954 2965 N/A INTRINSIC
low complexity region 3017 3029 N/A INTRINSIC
low complexity region 3215 3235 N/A INTRINSIC
low complexity region 3322 3360 N/A INTRINSIC
Pfam:SPOC 3488 3609 2.7e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142438
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142695
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144899
Meta Mutation Damage Score 0.156 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein involved in the regulation of c-myc. The symbol MIZ1 has also been associated with PIAS2 which is a different gene located on chromosome 18. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryonic development of homozygous null mice is severely impaired and death occurs prior to E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,753,849 V189A probably benign Het
Agtr1b G T 3: 20,315,779 A221D probably benign Het
Aldh18a1 A T 19: 40,570,561 D280E probably benign Het
Apob G A 12: 7,989,194 D475N probably benign Het
Bmi1 C T 2: 18,684,375 T290I probably benign Het
Brd8 A T 18: 34,613,239 D139E possibly damaging Het
Cacna1e C A 1: 154,441,524 V1467F possibly damaging Het
Cdh15 A G 8: 122,864,347 D445G probably benign Het
Ceacam5 T A 7: 17,747,198 L290H probably damaging Het
Celsr1 G T 15: 85,900,959 Q3025K probably benign Het
Chil1 T A 1: 134,182,258 M1K probably null Het
Crybg2 T C 4: 134,081,426 S1404P probably damaging Het
Cubn C A 2: 13,280,195 C3470F probably damaging Het
Cyp20a1 T C 1: 60,352,172 probably null Het
Cyp24a1 G T 2: 170,486,784 T408K probably benign Het
Cyp2a12 A T 7: 27,031,152 I181F possibly damaging Het
Dnm1l A T 16: 16,332,088 I268N probably damaging Het
Eif2a A G 3: 58,557,096 probably null Het
Epg5 T C 18: 77,962,398 F701S probably damaging Het
Fbxo46 T C 7: 19,136,541 S362P possibly damaging Het
Fgf22 A G 10: 79,756,996 probably benign Het
Fhod1 A C 8: 105,337,350 probably benign Het
Flnc T A 6: 29,459,063 V2448D probably damaging Het
Gm2696 G T 10: 77,836,138 probably benign Het
Gmpr T C 13: 45,532,398 S214P possibly damaging Het
Krt6a A G 15: 101,692,309 V308A probably damaging Het
Lig3 T A 11: 82,794,007 probably null Het
Lrrc37a T A 11: 103,504,051 N183Y probably benign Het
Mapk8ip3 C A 17: 24,906,905 G422V probably damaging Het
Mks1 T C 11: 87,855,499 S97P probably benign Het
Mphosph9 A T 5: 124,324,961 V7E probably damaging Het
Msh5 A G 17: 35,029,924 L711P probably damaging Het
Naga T A 15: 82,332,203 probably null Het
Nlrp10 T A 7: 108,925,746 T176S possibly damaging Het
Nqo1 T C 8: 107,388,950 N232D probably benign Het
Olfr11 T A 13: 21,639,248 I92L probably damaging Het
Olfr50 C G 2: 36,793,573 N112K possibly damaging Het
P2ry6 A G 7: 100,938,396 F252S probably damaging Het
P3h3 G A 6: 124,854,872 R317W probably benign Het
Palm2 T A 4: 57,710,173 C373S probably damaging Het
Pdzd3 A G 9: 44,248,683 V380A probably benign Het
Phkb T A 8: 85,875,698 D39E probably benign Het
Psg16 G A 7: 17,088,187 G23D probably damaging Het
Ptgr2 T A 12: 84,302,337 I150K probably benign Het
Ptprf A G 4: 118,212,814 V1457A probably benign Het
Sart3 A T 5: 113,751,240 Y508N probably benign Het
Sh3bp1 C T 15: 78,911,515 P615S probably damaging Het
Ska3 A T 14: 57,816,691 N267K probably benign Het
Slc26a7 A G 4: 14,524,498 I462T probably benign Het
Slu7 C T 11: 43,441,489 A244V probably benign Het
Smarca4 C T 9: 21,637,375 P319L probably damaging Het
Smg9 A G 7: 24,420,861 D420G probably benign Het
Strc T A 2: 121,374,958 D25V probably benign Het
Syne2 T G 12: 76,061,650 V936G probably damaging Het
Tbc1d7 C T 13: 43,152,933 probably benign Het
Terb1 C A 8: 104,447,199 D751Y probably damaging Het
Trpc1 A G 9: 95,721,250 Y410H probably damaging Het
Ush2a A G 1: 188,356,846 N333D probably benign Het
Usp34 T C 11: 23,452,520 S2438P probably damaging Het
Zfp7 G A 15: 76,890,610 G284D possibly damaging Het
Zfyve26 A G 12: 79,240,002 S2271P probably damaging Het
Zscan18 G A 7: 12,775,220 probably benign Het
Other mutations in Zbtb17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01137:Zbtb17 APN 4 141466367 nonsense probably null
IGL01449:Zbtb17 APN 4 141463305 missense probably benign
IGL01835:Zbtb17 APN 4 141465438 critical splice donor site probably null
IGL02141:Zbtb17 APN 4 141464953 missense probably damaging 1.00
IGL02142:Zbtb17 APN 4 141464982 missense probably benign 0.29
IGL02167:Zbtb17 APN 4 141461829 missense possibly damaging 0.94
IGL02388:Zbtb17 APN 4 141461913 missense probably damaging 1.00
IGL02600:Zbtb17 APN 4 141466885 missense possibly damaging 0.50
IGL02617:Zbtb17 APN 4 141465088 missense probably damaging 0.97
IGL03290:Zbtb17 APN 4 141466933 missense probably damaging 1.00
IGL03391:Zbtb17 APN 4 141466758 missense probably damaging 1.00
IGL02799:Zbtb17 UTSW 4 141463380 missense probably benign 0.20
R0698:Zbtb17 UTSW 4 141466096 unclassified probably null
R0736:Zbtb17 UTSW 4 141461786 missense probably damaging 1.00
R1924:Zbtb17 UTSW 4 141464603 missense probably damaging 1.00
R1940:Zbtb17 UTSW 4 141465548 missense possibly damaging 0.83
R2164:Zbtb17 UTSW 4 141464246 missense probably benign
R2517:Zbtb17 UTSW 4 141464585 missense probably damaging 1.00
R3424:Zbtb17 UTSW 4 141464988 missense probably damaging 0.99
R3884:Zbtb17 UTSW 4 141464575 missense probably damaging 1.00
R4609:Zbtb17 UTSW 4 141466498 missense probably damaging 1.00
R5055:Zbtb17 UTSW 4 141466549 missense possibly damaging 0.68
R5327:Zbtb17 UTSW 4 141465631 missense probably benign 0.22
R5363:Zbtb17 UTSW 4 141466761 missense probably benign 0.02
R5987:Zbtb17 UTSW 4 141464817 missense possibly damaging 0.94
R6038:Zbtb17 UTSW 4 141464441 missense probably benign 0.05
R6038:Zbtb17 UTSW 4 141464441 missense probably benign 0.05
R6311:Zbtb17 UTSW 4 141463383 missense probably benign 0.00
R6321:Zbtb17 UTSW 4 141463383 missense probably benign 0.00
R6322:Zbtb17 UTSW 4 141463383 missense probably benign 0.00
R6337:Zbtb17 UTSW 4 141463383 missense probably benign 0.00
R6365:Zbtb17 UTSW 4 141463383 missense probably benign 0.00
R6492:Zbtb17 UTSW 4 141463383 missense probably benign 0.00
R6605:Zbtb17 UTSW 4 141464950 missense probably damaging 0.99
R6695:Zbtb17 UTSW 4 141461799 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACTAGAGAAGTACCTAGGGGTC -3'
(R):5'- TTATGGGCGTGCATACCACC -3'

Sequencing Primer
(F):5'- AAGTACCTAGGGGTCCTGAG -3'
(R):5'- GTGCATACCACCAACCTCTCAG -3'
Posted On2018-04-02