Incidental Mutation 'R6320:Fgf22'
ID510106
Institutional Source Beutler Lab
Gene Symbol Fgf22
Ensembl Gene ENSMUSG00000020327
Gene Namefibroblast growth factor 22
Synonyms2210414E06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6320 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location79755076-79758596 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) A to G at 79756996 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020577] [ENSMUST00000047203] [ENSMUST00000219228] [ENSMUST00000219981]
Predicted Effect unknown
Transcript: ENSMUST00000020577
AA Change: T196A
SMART Domains Protein: ENSMUSP00000020577
Gene: ENSMUSG00000020327
AA Change: T196A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
FGF 30 159 1.73e-62 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047203
SMART Domains Protein: ENSMUSP00000039486
Gene: ENSMUSG00000035890

DomainStartEndE-ValueType
Pfam:zinc_ribbon_9 9 40 5e-11 PFAM
low complexity region 109 121 N/A INTRINSIC
low complexity region 124 139 N/A INTRINSIC
RING 231 271 5.68e-9 SMART
low complexity region 293 313 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219189
Predicted Effect probably benign
Transcript: ENSMUST00000219228
Predicted Effect probably benign
Transcript: ENSMUST00000219981
Meta Mutation Damage Score 0.0492 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities and are involved in a variety of biological processes including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. The mouse homolog of this gene was found to be preferentially expressed in the inner root sheath of the hair follicle, which suggested a role in hair development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired vesicle clustering in glutamatergic synapses, decreased miniature excitatory postsynaptic currents, enhanced paired-pulse facilitation, increased synaptic depression, and decreased susceptibility topentylenetetrazol-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,753,849 V189A probably benign Het
Agtr1b G T 3: 20,315,779 A221D probably benign Het
Aldh18a1 A T 19: 40,570,561 D280E probably benign Het
Apob G A 12: 7,989,194 D475N probably benign Het
Bmi1 C T 2: 18,684,375 T290I probably benign Het
Brd8 A T 18: 34,613,239 D139E possibly damaging Het
Cacna1e C A 1: 154,441,524 V1467F possibly damaging Het
Cdh15 A G 8: 122,864,347 D445G probably benign Het
Ceacam5 T A 7: 17,747,198 L290H probably damaging Het
Celsr1 G T 15: 85,900,959 Q3025K probably benign Het
Chil1 T A 1: 134,182,258 M1K probably null Het
Crybg2 T C 4: 134,081,426 S1404P probably damaging Het
Cubn C A 2: 13,280,195 C3470F probably damaging Het
Cyp20a1 T C 1: 60,352,172 probably null Het
Cyp24a1 G T 2: 170,486,784 T408K probably benign Het
Cyp2a12 A T 7: 27,031,152 I181F possibly damaging Het
Dnm1l A T 16: 16,332,088 I268N probably damaging Het
Eif2a A G 3: 58,557,096 probably null Het
Epg5 T C 18: 77,962,398 F701S probably damaging Het
Fbxo46 T C 7: 19,136,541 S362P possibly damaging Het
Fhod1 A C 8: 105,337,350 probably benign Het
Flnc T A 6: 29,459,063 V2448D probably damaging Het
Gm2696 G T 10: 77,836,138 probably benign Het
Gmpr T C 13: 45,532,398 S214P possibly damaging Het
Krt6a A G 15: 101,692,309 V308A probably damaging Het
Lig3 T A 11: 82,794,007 probably null Het
Lrrc37a T A 11: 103,504,051 N183Y probably benign Het
Mapk8ip3 C A 17: 24,906,905 G422V probably damaging Het
Mks1 T C 11: 87,855,499 S97P probably benign Het
Mphosph9 A T 5: 124,324,961 V7E probably damaging Het
Msh5 A G 17: 35,029,924 L711P probably damaging Het
Naga T A 15: 82,332,203 probably null Het
Nlrp10 T A 7: 108,925,746 T176S possibly damaging Het
Nqo1 T C 8: 107,388,950 N232D probably benign Het
Olfr11 T A 13: 21,639,248 I92L probably damaging Het
Olfr50 C G 2: 36,793,573 N112K possibly damaging Het
P2ry6 A G 7: 100,938,396 F252S probably damaging Het
P3h3 G A 6: 124,854,872 R317W probably benign Het
Palm2 T A 4: 57,710,173 C373S probably damaging Het
Pdzd3 A G 9: 44,248,683 V380A probably benign Het
Phkb T A 8: 85,875,698 D39E probably benign Het
Psg16 G A 7: 17,088,187 G23D probably damaging Het
Ptgr2 T A 12: 84,302,337 I150K probably benign Het
Ptprf A G 4: 118,212,814 V1457A probably benign Het
Sart3 A T 5: 113,751,240 Y508N probably benign Het
Sh3bp1 C T 15: 78,911,515 P615S probably damaging Het
Ska3 A T 14: 57,816,691 N267K probably benign Het
Slc26a7 A G 4: 14,524,498 I462T probably benign Het
Slu7 C T 11: 43,441,489 A244V probably benign Het
Smarca4 C T 9: 21,637,375 P319L probably damaging Het
Smg9 A G 7: 24,420,861 D420G probably benign Het
Strc T A 2: 121,374,958 D25V probably benign Het
Syne2 T G 12: 76,061,650 V936G probably damaging Het
Tbc1d7 C T 13: 43,152,933 probably benign Het
Terb1 C A 8: 104,447,199 D751Y probably damaging Het
Trpc1 A G 9: 95,721,250 Y410H probably damaging Het
Ush2a A G 1: 188,356,846 N333D probably benign Het
Usp34 T C 11: 23,452,520 S2438P probably damaging Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zfp7 G A 15: 76,890,610 G284D possibly damaging Het
Zfyve26 A G 12: 79,240,002 S2271P probably damaging Het
Zscan18 G A 7: 12,775,220 probably benign Het
Other mutations in Fgf22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00811:Fgf22 APN 10 79756890 missense probably damaging 1.00
IGL01667:Fgf22 APN 10 79756754 missense probably damaging 0.96
IGL02213:Fgf22 APN 10 79756615 missense probably damaging 1.00
R1108:Fgf22 UTSW 10 79756583 missense probably damaging 1.00
R1650:Fgf22 UTSW 10 79755189 missense probably damaging 1.00
R2138:Fgf22 UTSW 10 79756601 missense probably damaging 1.00
R5549:Fgf22 UTSW 10 79756862 missense probably damaging 1.00
R6289:Fgf22 UTSW 10 79755207 missense probably damaging 1.00
R7363:Fgf22 UTSW 10 79756842 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTACTCTGTGGACTGTAGGTTCC -3'
(R):5'- AACTGCCAGTTCTGTGTATCCC -3'

Sequencing Primer
(F):5'- ACTGTAGGTTCCGGGAGC -3'
(R):5'- TGTGTATCCCCCTGAGCG -3'
Posted On2018-04-02