Incidental Mutation 'R6320:Slu7'
ID510108
Institutional Source Beutler Lab
Gene Symbol Slu7
Ensembl Gene ENSMUSG00000020409
Gene NameSLU7 splicing factor homolog (S. cerevisiae)
SynonymsD3Bwg0878e, D11Ertd730e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6320 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location43433744-43447981 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 43441489 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 244 (A244V)
Ref Sequence ENSEMBL: ENSMUSP00000137281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020681] [ENSMUST00000126128] [ENSMUST00000151880] [ENSMUST00000178622]
Predicted Effect probably benign
Transcript: ENSMUST00000020681
AA Change: A244V

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000020681
Gene: ENSMUSG00000020409
AA Change: A244V

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
ZnF_C2HC 119 135 4.08e-1 SMART
Pfam:Slu7 160 434 1.3e-90 PFAM
coiled coil region 484 543 N/A INTRINSIC
low complexity region 555 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126128
SMART Domains Protein: ENSMUSP00000122142
Gene: ENSMUSG00000020409

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136541
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149402
Predicted Effect probably benign
Transcript: ENSMUST00000151880
AA Change: A244V

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000116609
Gene: ENSMUSG00000020409
AA Change: A244V

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
ZnF_C2HC 119 135 4.08e-1 SMART
Pfam:Slu7 160 434 2.4e-91 PFAM
low complexity region 486 497 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178622
AA Change: A244V

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000137281
Gene: ENSMUSG00000020409
AA Change: A244V

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
ZnF_C2HC 119 135 4.08e-1 SMART
Pfam:Slu7 161 434 1.6e-112 PFAM
coiled coil region 484 543 N/A INTRINSIC
low complexity region 555 570 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: Pre-mRNA splicing occurs in two sequential transesterification steps. The protein encoded by this gene is a splicing factor that has been found to be essential during the second catalytic step in the pre-mRNA splicing process. It associates with the spliceosome and contains a zinc knuckle motif that is found in other splicing factors and is involved in protein-nucleic acid and protein-protein interactions. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,753,849 V189A probably benign Het
Agtr1b G T 3: 20,315,779 A221D probably benign Het
Aldh18a1 A T 19: 40,570,561 D280E probably benign Het
Apob G A 12: 7,989,194 D475N probably benign Het
Bmi1 C T 2: 18,684,375 T290I probably benign Het
Brd8 A T 18: 34,613,239 D139E possibly damaging Het
Cacna1e C A 1: 154,441,524 V1467F possibly damaging Het
Cdh15 A G 8: 122,864,347 D445G probably benign Het
Ceacam5 T A 7: 17,747,198 L290H probably damaging Het
Celsr1 G T 15: 85,900,959 Q3025K probably benign Het
Chil1 T A 1: 134,182,258 M1K probably null Het
Crybg2 T C 4: 134,081,426 S1404P probably damaging Het
Cubn C A 2: 13,280,195 C3470F probably damaging Het
Cyp20a1 T C 1: 60,352,172 probably null Het
Cyp24a1 G T 2: 170,486,784 T408K probably benign Het
Cyp2a12 A T 7: 27,031,152 I181F possibly damaging Het
Dnm1l A T 16: 16,332,088 I268N probably damaging Het
Eif2a A G 3: 58,557,096 probably null Het
Epg5 T C 18: 77,962,398 F701S probably damaging Het
Fbxo46 T C 7: 19,136,541 S362P possibly damaging Het
Fgf22 A G 10: 79,756,996 probably benign Het
Fhod1 A C 8: 105,337,350 probably benign Het
Flnc T A 6: 29,459,063 V2448D probably damaging Het
Gm2696 G T 10: 77,836,138 probably benign Het
Gmpr T C 13: 45,532,398 S214P possibly damaging Het
Krt6a A G 15: 101,692,309 V308A probably damaging Het
Lig3 T A 11: 82,794,007 probably null Het
Lrrc37a T A 11: 103,504,051 N183Y probably benign Het
Mapk8ip3 C A 17: 24,906,905 G422V probably damaging Het
Mks1 T C 11: 87,855,499 S97P probably benign Het
Mphosph9 A T 5: 124,324,961 V7E probably damaging Het
Msh5 A G 17: 35,029,924 L711P probably damaging Het
Naga T A 15: 82,332,203 probably null Het
Nlrp10 T A 7: 108,925,746 T176S possibly damaging Het
Nqo1 T C 8: 107,388,950 N232D probably benign Het
Olfr11 T A 13: 21,639,248 I92L probably damaging Het
Olfr50 C G 2: 36,793,573 N112K possibly damaging Het
P2ry6 A G 7: 100,938,396 F252S probably damaging Het
P3h3 G A 6: 124,854,872 R317W probably benign Het
Palm2 T A 4: 57,710,173 C373S probably damaging Het
Pdzd3 A G 9: 44,248,683 V380A probably benign Het
Phkb T A 8: 85,875,698 D39E probably benign Het
Psg16 G A 7: 17,088,187 G23D probably damaging Het
Ptgr2 T A 12: 84,302,337 I150K probably benign Het
Ptprf A G 4: 118,212,814 V1457A probably benign Het
Sart3 A T 5: 113,751,240 Y508N probably benign Het
Sh3bp1 C T 15: 78,911,515 P615S probably damaging Het
Ska3 A T 14: 57,816,691 N267K probably benign Het
Slc26a7 A G 4: 14,524,498 I462T probably benign Het
Smarca4 C T 9: 21,637,375 P319L probably damaging Het
Smg9 A G 7: 24,420,861 D420G probably benign Het
Strc T A 2: 121,374,958 D25V probably benign Het
Syne2 T G 12: 76,061,650 V936G probably damaging Het
Tbc1d7 C T 13: 43,152,933 probably benign Het
Terb1 C A 8: 104,447,199 D751Y probably damaging Het
Trpc1 A G 9: 95,721,250 Y410H probably damaging Het
Ush2a A G 1: 188,356,846 N333D probably benign Het
Usp34 T C 11: 23,452,520 S2438P probably damaging Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zfp7 G A 15: 76,890,610 G284D possibly damaging Het
Zfyve26 A G 12: 79,240,002 S2271P probably damaging Het
Zscan18 G A 7: 12,775,220 probably benign Het
Other mutations in Slu7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01886:Slu7 APN 11 43439260 missense probably damaging 1.00
IGL02212:Slu7 APN 11 43440642 missense probably benign 0.05
IGL02657:Slu7 APN 11 43442022 splice site probably null
IGL02671:Slu7 APN 11 43445475 splice site probably null
IGL02702:Slu7 APN 11 43438892 splice site probably benign
IGL02720:Slu7 APN 11 43445203 missense probably benign 0.00
IGL02831:Slu7 APN 11 43442653 nonsense probably null
IGL03104:Slu7 APN 11 43442056 missense probably benign 0.36
IGL03106:Slu7 APN 11 43442630 missense possibly damaging 0.46
R0571:Slu7 UTSW 11 43441578 critical splice donor site probably null
R1498:Slu7 UTSW 11 43438217 missense possibly damaging 0.78
R1753:Slu7 UTSW 11 43439268 missense probably benign 0.40
R1789:Slu7 UTSW 11 43445242 missense probably benign 0.00
R2655:Slu7 UTSW 11 43440648 missense probably benign 0.03
R2941:Slu7 UTSW 11 43444757 missense probably benign 0.06
R3916:Slu7 UTSW 11 43440684 splice site probably null
R3917:Slu7 UTSW 11 43440684 splice site probably null
R4084:Slu7 UTSW 11 43443391 missense probably benign 0.03
R4393:Slu7 UTSW 11 43439269 missense possibly damaging 0.89
R5656:Slu7 UTSW 11 43443418 missense probably benign 0.03
R5884:Slu7 UTSW 11 43443418 missense probably benign 0.03
R6517:Slu7 UTSW 11 43438148 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGATGGTAAGGCGTGCTG -3'
(R):5'- AGCATACGTGTAGGTCCTGTAC -3'

Sequencing Primer
(F):5'- TGGCTGCAAGCTCTCCTAG -3'
(R):5'- GTTGCCGGCCTTCCAAGTAC -3'
Posted On2018-04-02