Incidental Mutation 'R6320:Ska3'
ID510119
Institutional Source Beutler Lab
Gene Symbol Ska3
Ensembl Gene ENSMUSG00000021965
Gene Namespindle and kinetochore associated complex subunit 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.902) question?
Stock #R6320 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location57806561-57826185 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57816691 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 267 (N267K)
Ref Sequence ENSEMBL: ENSMUSP00000022536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022536]
Predicted Effect probably benign
Transcript: ENSMUST00000022536
AA Change: N267K

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000022536
Gene: ENSMUSG00000021965
AA Change: N267K

DomainStartEndE-ValueType
PDB:4AJ5|Z 1 101 3e-46 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225646
Meta Mutation Damage Score 0.282 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the spindle and kinetochore-associated protein complex that regulates microtubule attachment to the kinetochores during mitosis. The encoded protein localizes to the outer kinetechore and may be required for normal chromosome segregation and cell division. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,753,849 V189A probably benign Het
Agtr1b G T 3: 20,315,779 A221D probably benign Het
Aldh18a1 A T 19: 40,570,561 D280E probably benign Het
Apob G A 12: 7,989,194 D475N probably benign Het
Bmi1 C T 2: 18,684,375 T290I probably benign Het
Brd8 A T 18: 34,613,239 D139E possibly damaging Het
Cacna1e C A 1: 154,441,524 V1467F possibly damaging Het
Cdh15 A G 8: 122,864,347 D445G probably benign Het
Ceacam5 T A 7: 17,747,198 L290H probably damaging Het
Celsr1 G T 15: 85,900,959 Q3025K probably benign Het
Chil1 T A 1: 134,182,258 M1K probably null Het
Crybg2 T C 4: 134,081,426 S1404P probably damaging Het
Cubn C A 2: 13,280,195 C3470F probably damaging Het
Cyp20a1 T C 1: 60,352,172 probably null Het
Cyp24a1 G T 2: 170,486,784 T408K probably benign Het
Cyp2a12 A T 7: 27,031,152 I181F possibly damaging Het
Dnm1l A T 16: 16,332,088 I268N probably damaging Het
Eif2a A G 3: 58,557,096 probably null Het
Epg5 T C 18: 77,962,398 F701S probably damaging Het
Fbxo46 T C 7: 19,136,541 S362P possibly damaging Het
Fgf22 A G 10: 79,756,996 probably benign Het
Fhod1 A C 8: 105,337,350 probably benign Het
Flnc T A 6: 29,459,063 V2448D probably damaging Het
Gm2696 G T 10: 77,836,138 probably benign Het
Gmpr T C 13: 45,532,398 S214P possibly damaging Het
Krt6a A G 15: 101,692,309 V308A probably damaging Het
Lig3 T A 11: 82,794,007 probably null Het
Lrrc37a T A 11: 103,504,051 N183Y probably benign Het
Mapk8ip3 C A 17: 24,906,905 G422V probably damaging Het
Mks1 T C 11: 87,855,499 S97P probably benign Het
Mphosph9 A T 5: 124,324,961 V7E probably damaging Het
Msh5 A G 17: 35,029,924 L711P probably damaging Het
Naga T A 15: 82,332,203 probably null Het
Nlrp10 T A 7: 108,925,746 T176S possibly damaging Het
Nqo1 T C 8: 107,388,950 N232D probably benign Het
Olfr11 T A 13: 21,639,248 I92L probably damaging Het
Olfr50 C G 2: 36,793,573 N112K possibly damaging Het
P2ry6 A G 7: 100,938,396 F252S probably damaging Het
P3h3 G A 6: 124,854,872 R317W probably benign Het
Palm2 T A 4: 57,710,173 C373S probably damaging Het
Pdzd3 A G 9: 44,248,683 V380A probably benign Het
Phkb T A 8: 85,875,698 D39E probably benign Het
Psg16 G A 7: 17,088,187 G23D probably damaging Het
Ptgr2 T A 12: 84,302,337 I150K probably benign Het
Ptprf A G 4: 118,212,814 V1457A probably benign Het
Sart3 A T 5: 113,751,240 Y508N probably benign Het
Sh3bp1 C T 15: 78,911,515 P615S probably damaging Het
Slc26a7 A G 4: 14,524,498 I462T probably benign Het
Slu7 C T 11: 43,441,489 A244V probably benign Het
Smarca4 C T 9: 21,637,375 P319L probably damaging Het
Smg9 A G 7: 24,420,861 D420G probably benign Het
Strc T A 2: 121,374,958 D25V probably benign Het
Syne2 T G 12: 76,061,650 V936G probably damaging Het
Tbc1d7 C T 13: 43,152,933 probably benign Het
Terb1 C A 8: 104,447,199 D751Y probably damaging Het
Trpc1 A G 9: 95,721,250 Y410H probably damaging Het
Ush2a A G 1: 188,356,846 N333D probably benign Het
Usp34 T C 11: 23,452,520 S2438P probably damaging Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zfp7 G A 15: 76,890,610 G284D possibly damaging Het
Zfyve26 A G 12: 79,240,002 S2271P probably damaging Het
Zscan18 G A 7: 12,775,220 probably benign Het
Other mutations in Ska3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Ska3 APN 14 57822124 missense possibly damaging 0.95
IGL01969:Ska3 APN 14 57811662 missense probably benign 0.00
IGL02539:Ska3 APN 14 57820511 missense possibly damaging 0.86
IGL02665:Ska3 APN 14 57822072 missense probably damaging 1.00
R1276:Ska3 UTSW 14 57820269 missense probably damaging 1.00
R3737:Ska3 UTSW 14 57811596 missense probably benign 0.00
R3738:Ska3 UTSW 14 57811596 missense probably benign 0.00
R3771:Ska3 UTSW 14 57810077 missense probably benign 0.06
R3772:Ska3 UTSW 14 57810077 missense probably benign 0.06
R3773:Ska3 UTSW 14 57810077 missense probably benign 0.06
R5269:Ska3 UTSW 14 57822116 missense possibly damaging 0.87
R6088:Ska3 UTSW 14 57816694 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGCAGCAAATAAAACGAGTACTAC -3'
(R):5'- TGATGGCTTCCATTGGTCC -3'

Sequencing Primer
(F):5'- AAGCCATATGCCTCGATTGG -3'
(R):5'- TCCTTATTTCATAAACCAAACTGAGC -3'
Posted On2018-04-02