Incidental Mutation 'R6320:Brd8'
ID510127
Institutional Source Beutler Lab
Gene Symbol Brd8
Ensembl Gene ENSMUSG00000003778
Gene Namebromodomain containing 8
Synonyms2610007E11Rik, 4432404P07Rik, SMAP, p120
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6320 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location34598615-34624601 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34613239 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 139 (D139E)
Ref Sequence ENSEMBL: ENSMUSP00000095229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003876] [ENSMUST00000097626] [ENSMUST00000115765] [ENSMUST00000115766]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003876
AA Change: D139E

PolyPhen 2 Score 0.678 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000003876
Gene: ENSMUSG00000003778
AA Change: D139E

DomainStartEndE-ValueType
Blast:SANT 15 74 4e-33 BLAST
coiled coil region 97 132 N/A INTRINSIC
low complexity region 148 161 N/A INTRINSIC
low complexity region 265 282 N/A INTRINSIC
low complexity region 323 339 N/A INTRINSIC
low complexity region 363 378 N/A INTRINSIC
low complexity region 386 404 N/A INTRINSIC
low complexity region 505 516 N/A INTRINSIC
low complexity region 759 773 N/A INTRINSIC
BROMO 778 886 7.59e-40 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000097626
AA Change: D139E

PolyPhen 2 Score 0.678 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000095229
Gene: ENSMUSG00000003778
AA Change: D139E

DomainStartEndE-ValueType
Blast:SANT 15 74 3e-33 BLAST
coiled coil region 97 132 N/A INTRINSIC
low complexity region 148 161 N/A INTRINSIC
low complexity region 250 266 N/A INTRINSIC
low complexity region 290 305 N/A INTRINSIC
low complexity region 313 331 N/A INTRINSIC
low complexity region 432 443 N/A INTRINSIC
low complexity region 686 700 N/A INTRINSIC
BROMO 705 813 7.59e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115765
AA Change: D139E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000111431
Gene: ENSMUSG00000003778
AA Change: D139E

DomainStartEndE-ValueType
Blast:SANT 15 74 5e-33 BLAST
coiled coil region 97 132 N/A INTRINSIC
low complexity region 148 161 N/A INTRINSIC
low complexity region 265 282 N/A INTRINSIC
low complexity region 323 339 N/A INTRINSIC
low complexity region 363 378 N/A INTRINSIC
low complexity region 386 404 N/A INTRINSIC
low complexity region 505 516 N/A INTRINSIC
low complexity region 759 773 N/A INTRINSIC
BROMO 778 886 7.59e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115766
AA Change: D139E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111432
Gene: ENSMUSG00000003778
AA Change: D139E

DomainStartEndE-ValueType
Blast:SANT 15 74 4e-33 BLAST
coiled coil region 97 132 N/A INTRINSIC
low complexity region 148 161 N/A INTRINSIC
low complexity region 265 282 N/A INTRINSIC
low complexity region 323 337 N/A INTRINSIC
low complexity region 435 446 N/A INTRINSIC
low complexity region 689 703 N/A INTRINSIC
BROMO 708 816 7.59e-40 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145431
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152612
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153569
Meta Mutation Damage Score 0.162 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with thyroid hormone receptor in a ligand-dependent manner and enhances thyroid hormone-dependent activation from thyroid response elements. This protein contains a bromodomain and is thought to be a nuclear receptor coactivator. Multiple alternatively spliced transcript variants that encode distinct isoforms have been identified. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,753,849 V189A probably benign Het
Agtr1b G T 3: 20,315,779 A221D probably benign Het
Aldh18a1 A T 19: 40,570,561 D280E probably benign Het
Apob G A 12: 7,989,194 D475N probably benign Het
Bmi1 C T 2: 18,684,375 T290I probably benign Het
Cacna1e C A 1: 154,441,524 V1467F possibly damaging Het
Cdh15 A G 8: 122,864,347 D445G probably benign Het
Ceacam5 T A 7: 17,747,198 L290H probably damaging Het
Celsr1 G T 15: 85,900,959 Q3025K probably benign Het
Chil1 T A 1: 134,182,258 M1K probably null Het
Crybg2 T C 4: 134,081,426 S1404P probably damaging Het
Cubn C A 2: 13,280,195 C3470F probably damaging Het
Cyp20a1 T C 1: 60,352,172 probably null Het
Cyp24a1 G T 2: 170,486,784 T408K probably benign Het
Cyp2a12 A T 7: 27,031,152 I181F possibly damaging Het
Dnm1l A T 16: 16,332,088 I268N probably damaging Het
Eif2a A G 3: 58,557,096 probably null Het
Epg5 T C 18: 77,962,398 F701S probably damaging Het
Fbxo46 T C 7: 19,136,541 S362P possibly damaging Het
Fgf22 A G 10: 79,756,996 probably benign Het
Fhod1 A C 8: 105,337,350 probably benign Het
Flnc T A 6: 29,459,063 V2448D probably damaging Het
Gm2696 G T 10: 77,836,138 probably benign Het
Gmpr T C 13: 45,532,398 S214P possibly damaging Het
Krt6a A G 15: 101,692,309 V308A probably damaging Het
Lig3 T A 11: 82,794,007 probably null Het
Lrrc37a T A 11: 103,504,051 N183Y probably benign Het
Mapk8ip3 C A 17: 24,906,905 G422V probably damaging Het
Mks1 T C 11: 87,855,499 S97P probably benign Het
Mphosph9 A T 5: 124,324,961 V7E probably damaging Het
Msh5 A G 17: 35,029,924 L711P probably damaging Het
Naga T A 15: 82,332,203 probably null Het
Nlrp10 T A 7: 108,925,746 T176S possibly damaging Het
Nqo1 T C 8: 107,388,950 N232D probably benign Het
Olfr11 T A 13: 21,639,248 I92L probably damaging Het
Olfr50 C G 2: 36,793,573 N112K possibly damaging Het
P2ry6 A G 7: 100,938,396 F252S probably damaging Het
P3h3 G A 6: 124,854,872 R317W probably benign Het
Palm2 T A 4: 57,710,173 C373S probably damaging Het
Pdzd3 A G 9: 44,248,683 V380A probably benign Het
Phkb T A 8: 85,875,698 D39E probably benign Het
Psg16 G A 7: 17,088,187 G23D probably damaging Het
Ptgr2 T A 12: 84,302,337 I150K probably benign Het
Ptprf A G 4: 118,212,814 V1457A probably benign Het
Sart3 A T 5: 113,751,240 Y508N probably benign Het
Sh3bp1 C T 15: 78,911,515 P615S probably damaging Het
Ska3 A T 14: 57,816,691 N267K probably benign Het
Slc26a7 A G 4: 14,524,498 I462T probably benign Het
Slu7 C T 11: 43,441,489 A244V probably benign Het
Smarca4 C T 9: 21,637,375 P319L probably damaging Het
Smg9 A G 7: 24,420,861 D420G probably benign Het
Strc T A 2: 121,374,958 D25V probably benign Het
Syne2 T G 12: 76,061,650 V936G probably damaging Het
Tbc1d7 C T 13: 43,152,933 probably benign Het
Terb1 C A 8: 104,447,199 D751Y probably damaging Het
Trpc1 A G 9: 95,721,250 Y410H probably damaging Het
Ush2a A G 1: 188,356,846 N333D probably benign Het
Usp34 T C 11: 23,452,520 S2438P probably damaging Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zfp7 G A 15: 76,890,610 G284D possibly damaging Het
Zfyve26 A G 12: 79,240,002 S2271P probably damaging Het
Zscan18 G A 7: 12,775,220 probably benign Het
Other mutations in Brd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Brd8 APN 18 34609883 nonsense probably null
IGL01734:Brd8 APN 18 34614805 splice site probably benign
IGL02064:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02065:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02067:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02118:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02120:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02121:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02122:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02123:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02125:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02126:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02160:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02163:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02164:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02166:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02211:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02212:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02216:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02217:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02219:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02397:Brd8 APN 18 34604873 missense probably damaging 0.99
IGL02642:Brd8 APN 18 34608064 splice site probably benign
IGL02820:Brd8 APN 18 34607301 missense probably benign 0.01
IGL02942:Brd8 APN 18 34610627 missense possibly damaging 0.92
IGL03121:Brd8 APN 18 34606687 missense probably damaging 0.99
IGL03174:Brd8 APN 18 34604909 missense probably damaging 1.00
IGL03304:Brd8 APN 18 34614580 splice site probably benign
R0226:Brd8 UTSW 18 34603894 splice site probably benign
R1269:Brd8 UTSW 18 34609804 critical splice donor site probably null
R1654:Brd8 UTSW 18 34611226 missense probably damaging 1.00
R1692:Brd8 UTSW 18 34609833 missense probably damaging 0.99
R1714:Brd8 UTSW 18 34609833 missense probably damaging 0.99
R1874:Brd8 UTSW 18 34610474 missense probably damaging 1.00
R1965:Brd8 UTSW 18 34602766 missense probably damaging 1.00
R1973:Brd8 UTSW 18 34608013 missense probably damaging 1.00
R2069:Brd8 UTSW 18 34614479 missense probably damaging 1.00
R3952:Brd8 UTSW 18 34614444 splice site probably benign
R4411:Brd8 UTSW 18 34623444 unclassified probably benign
R4634:Brd8 UTSW 18 34608484 missense possibly damaging 0.78
R4650:Brd8 UTSW 18 34606699 missense probably benign 0.06
R4919:Brd8 UTSW 18 34607436 missense probably damaging 0.99
R4925:Brd8 UTSW 18 34607335 missense probably benign 0.02
R4948:Brd8 UTSW 18 34614532 missense probably damaging 1.00
R5328:Brd8 UTSW 18 34607981 missense probably benign 0.29
R5489:Brd8 UTSW 18 34608645 intron probably null
R5841:Brd8 UTSW 18 34605523 missense probably damaging 1.00
R6306:Brd8 UTSW 18 34611251 missense probably damaging 0.97
R6808:Brd8 UTSW 18 34608475 missense probably damaging 0.98
R7149:Brd8 UTSW 18 34604597 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TAAACTCAGCTCACCCTGGTAC -3'
(R):5'- GCTGTGAAATGTGTCCACCTG -3'

Sequencing Primer
(F):5'- TCACCCTGGTACGCAGCATC -3'
(R):5'- GTCTACACAGTGAGTTCCAGGAC -3'
Posted On2018-04-02