Incidental Mutation 'R6320:Epg5'
ID510128
Institutional Source Beutler Lab
Gene Symbol Epg5
Ensembl Gene ENSMUSG00000039840
Gene Nameectopic P-granules autophagy protein 5 homolog (C. elegans)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.927) question?
Stock #R6320 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location77938467-78035027 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77962398 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 701 (F701S)
Ref Sequence ENSEMBL: ENSMUSP00000038681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044622]
Predicted Effect probably damaging
Transcript: ENSMUST00000044622
AA Change: F701S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038681
Gene: ENSMUSG00000039840
AA Change: F701S

DomainStartEndE-ValueType
low complexity region 299 309 N/A INTRINSIC
low complexity region 395 406 N/A INTRINSIC
low complexity region 1074 1085 N/A INTRINSIC
low complexity region 1499 1516 N/A INTRINSIC
coiled coil region 1600 1626 N/A INTRINSIC
low complexity region 2132 2145 N/A INTRINSIC
low complexity region 2416 2427 N/A INTRINSIC
low complexity region 2454 2469 N/A INTRINSIC
Meta Mutation Damage Score 0.264 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled coil domain-containing protein that functions in autophagy during starvation conditions. Mutations in this gene cause Vici syndrome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit dysfunctional autophagy that leads to aggregate inclusions in motor neurons, motor neuron degeneration, denervation, muscle degeneration and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,753,849 V189A probably benign Het
Agtr1b G T 3: 20,315,779 A221D probably benign Het
Aldh18a1 A T 19: 40,570,561 D280E probably benign Het
Apob G A 12: 7,989,194 D475N probably benign Het
Bmi1 C T 2: 18,684,375 T290I probably benign Het
Brd8 A T 18: 34,613,239 D139E possibly damaging Het
Cacna1e C A 1: 154,441,524 V1467F possibly damaging Het
Cdh15 A G 8: 122,864,347 D445G probably benign Het
Ceacam5 T A 7: 17,747,198 L290H probably damaging Het
Celsr1 G T 15: 85,900,959 Q3025K probably benign Het
Chil1 T A 1: 134,182,258 M1K probably null Het
Crybg2 T C 4: 134,081,426 S1404P probably damaging Het
Cubn C A 2: 13,280,195 C3470F probably damaging Het
Cyp20a1 T C 1: 60,352,172 probably null Het
Cyp24a1 G T 2: 170,486,784 T408K probably benign Het
Cyp2a12 A T 7: 27,031,152 I181F possibly damaging Het
Dnm1l A T 16: 16,332,088 I268N probably damaging Het
Eif2a A G 3: 58,557,096 probably null Het
Fbxo46 T C 7: 19,136,541 S362P possibly damaging Het
Fgf22 A G 10: 79,756,996 probably benign Het
Fhod1 A C 8: 105,337,350 probably benign Het
Flnc T A 6: 29,459,063 V2448D probably damaging Het
Gm2696 G T 10: 77,836,138 probably benign Het
Gmpr T C 13: 45,532,398 S214P possibly damaging Het
Krt6a A G 15: 101,692,309 V308A probably damaging Het
Lig3 T A 11: 82,794,007 probably null Het
Lrrc37a T A 11: 103,504,051 N183Y probably benign Het
Mapk8ip3 C A 17: 24,906,905 G422V probably damaging Het
Mks1 T C 11: 87,855,499 S97P probably benign Het
Mphosph9 A T 5: 124,324,961 V7E probably damaging Het
Msh5 A G 17: 35,029,924 L711P probably damaging Het
Naga T A 15: 82,332,203 probably null Het
Nlrp10 T A 7: 108,925,746 T176S possibly damaging Het
Nqo1 T C 8: 107,388,950 N232D probably benign Het
Olfr11 T A 13: 21,639,248 I92L probably damaging Het
Olfr50 C G 2: 36,793,573 N112K possibly damaging Het
P2ry6 A G 7: 100,938,396 F252S probably damaging Het
P3h3 G A 6: 124,854,872 R317W probably benign Het
Palm2 T A 4: 57,710,173 C373S probably damaging Het
Pdzd3 A G 9: 44,248,683 V380A probably benign Het
Phkb T A 8: 85,875,698 D39E probably benign Het
Psg16 G A 7: 17,088,187 G23D probably damaging Het
Ptgr2 T A 12: 84,302,337 I150K probably benign Het
Ptprf A G 4: 118,212,814 V1457A probably benign Het
Sart3 A T 5: 113,751,240 Y508N probably benign Het
Sh3bp1 C T 15: 78,911,515 P615S probably damaging Het
Ska3 A T 14: 57,816,691 N267K probably benign Het
Slc26a7 A G 4: 14,524,498 I462T probably benign Het
Slu7 C T 11: 43,441,489 A244V probably benign Het
Smarca4 C T 9: 21,637,375 P319L probably damaging Het
Smg9 A G 7: 24,420,861 D420G probably benign Het
Strc T A 2: 121,374,958 D25V probably benign Het
Syne2 T G 12: 76,061,650 V936G probably damaging Het
Tbc1d7 C T 13: 43,152,933 probably benign Het
Terb1 C A 8: 104,447,199 D751Y probably damaging Het
Trpc1 A G 9: 95,721,250 Y410H probably damaging Het
Ush2a A G 1: 188,356,846 N333D probably benign Het
Usp34 T C 11: 23,452,520 S2438P probably damaging Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zfp7 G A 15: 76,890,610 G284D possibly damaging Het
Zfyve26 A G 12: 79,240,002 S2271P probably damaging Het
Zscan18 G A 7: 12,775,220 probably benign Het
Other mutations in Epg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01680:Epg5 APN 18 78012741 missense probably damaging 1.00
IGL01778:Epg5 APN 18 78019274 missense probably damaging 0.98
IGL01936:Epg5 APN 18 77985101 missense probably damaging 1.00
IGL02189:Epg5 APN 18 78012870 missense probably damaging 0.99
IGL02323:Epg5 APN 18 78012832 nonsense probably null
IGL02567:Epg5 APN 18 78033073 missense probably damaging 1.00
IGL02805:Epg5 APN 18 78030191 splice site probably benign
IGL03282:Epg5 APN 18 77986426 missense probably benign 0.25
stitch UTSW 18 77948299 nonsense probably null
R0011:Epg5 UTSW 18 77948483 missense probably benign
R0172:Epg5 UTSW 18 78027359 missense probably benign 0.00
R0335:Epg5 UTSW 18 77986472 missense probably benign 0.25
R0380:Epg5 UTSW 18 77960841 missense probably damaging 1.00
R0441:Epg5 UTSW 18 78023271 splice site probably benign
R0443:Epg5 UTSW 18 77955903 splice site probably benign
R0445:Epg5 UTSW 18 78014184 missense possibly damaging 0.87
R0448:Epg5 UTSW 18 78023365 missense probably damaging 1.00
R0892:Epg5 UTSW 18 77968628 missense possibly damaging 0.94
R1081:Epg5 UTSW 18 77959533 missense possibly damaging 0.92
R1183:Epg5 UTSW 18 77960711 missense probably damaging 1.00
R1374:Epg5 UTSW 18 77981326 missense probably benign
R1428:Epg5 UTSW 18 77962427 missense probably damaging 1.00
R1727:Epg5 UTSW 18 78015815 missense possibly damaging 0.94
R1780:Epg5 UTSW 18 78023990 missense probably damaging 0.99
R1801:Epg5 UTSW 18 77983490 missense possibly damaging 0.63
R1864:Epg5 UTSW 18 77975031 missense probably damaging 0.99
R1908:Epg5 UTSW 18 77959032 missense probably benign 0.26
R1909:Epg5 UTSW 18 77959032 missense probably benign 0.26
R1916:Epg5 UTSW 18 77965021 missense probably benign 0.00
R1986:Epg5 UTSW 18 77982306 critical splice acceptor site probably null
R2048:Epg5 UTSW 18 78023987 missense probably damaging 0.98
R2080:Epg5 UTSW 18 77948745 missense probably benign 0.01
R2106:Epg5 UTSW 18 77991363 nonsense probably null
R2144:Epg5 UTSW 18 77954197 missense possibly damaging 0.78
R2151:Epg5 UTSW 18 78027302 missense probably benign
R2217:Epg5 UTSW 18 77949072 missense probably benign
R2424:Epg5 UTSW 18 77968613 missense probably benign 0.05
R2909:Epg5 UTSW 18 77983476 missense probably damaging 1.00
R3725:Epg5 UTSW 18 78017679 missense probably benign 0.00
R3899:Epg5 UTSW 18 77957510 missense probably damaging 1.00
R4019:Epg5 UTSW 18 78030450 missense probably damaging 0.98
R4260:Epg5 UTSW 18 77959121 missense possibly damaging 0.50
R4260:Epg5 UTSW 18 78015699 missense probably damaging 1.00
R4448:Epg5 UTSW 18 77962461 missense probably damaging 1.00
R4475:Epg5 UTSW 18 77948508 missense probably benign
R4612:Epg5 UTSW 18 77982414 missense possibly damaging 0.77
R4666:Epg5 UTSW 18 78012864 missense probably benign 0.45
R4767:Epg5 UTSW 18 78023283 missense possibly damaging 0.67
R4779:Epg5 UTSW 18 77991365 missense probably benign 0.01
R4791:Epg5 UTSW 18 77948996 nonsense probably null
R4797:Epg5 UTSW 18 78030399 missense probably benign 0.00
R4812:Epg5 UTSW 18 77979184 missense probably benign 0.01
R4899:Epg5 UTSW 18 77985057 missense probably damaging 1.00
R5000:Epg5 UTSW 18 77954161 missense probably benign
R5031:Epg5 UTSW 18 78028948 missense probably benign 0.00
R5050:Epg5 UTSW 18 77975941 missense possibly damaging 0.55
R5114:Epg5 UTSW 18 77995613 missense probably benign
R5144:Epg5 UTSW 18 78015680 missense probably damaging 1.00
R5209:Epg5 UTSW 18 77951282 missense probably damaging 1.00
R5213:Epg5 UTSW 18 78014834 missense probably benign 0.01
R5270:Epg5 UTSW 18 77983563 missense possibly damaging 0.79
R5324:Epg5 UTSW 18 77962445 missense possibly damaging 0.94
R5443:Epg5 UTSW 18 78027497 missense possibly damaging 0.55
R5503:Epg5 UTSW 18 77951207 missense possibly damaging 0.81
R5593:Epg5 UTSW 18 77957474 missense probably damaging 1.00
R5718:Epg5 UTSW 18 77986403 missense probably damaging 1.00
R5773:Epg5 UTSW 18 77960825 missense probably damaging 1.00
R5828:Epg5 UTSW 18 78020851 missense probably damaging 0.99
R5847:Epg5 UTSW 18 78030055 missense probably benign 0.06
R5858:Epg5 UTSW 18 77948299 nonsense probably null
R5914:Epg5 UTSW 18 77959632 critical splice donor site probably null
R6124:Epg5 UTSW 18 78030045 missense probably benign
R6228:Epg5 UTSW 18 77948462 missense possibly damaging 0.90
R6252:Epg5 UTSW 18 77985167 missense probably damaging 1.00
R6269:Epg5 UTSW 18 77948370 missense probably benign
R6312:Epg5 UTSW 18 77979211 missense possibly damaging 0.72
R6328:Epg5 UTSW 18 78028964 missense possibly damaging 0.88
R6430:Epg5 UTSW 18 77975885 missense probably damaging 1.00
R6458:Epg5 UTSW 18 77948254 missense probably benign 0.03
R6852:Epg5 UTSW 18 78012891 missense probably damaging 1.00
R6915:Epg5 UTSW 18 77979165 missense probably benign 0.00
R6930:Epg5 UTSW 18 78014163 missense probably damaging 0.99
R6932:Epg5 UTSW 18 77948609 missense probably benign 0.00
R7127:Epg5 UTSW 18 78028925 missense probably damaging 1.00
R7207:Epg5 UTSW 18 77948955 missense probably damaging 1.00
R7225:Epg5 UTSW 18 78012702 missense probably benign 0.45
R7358:Epg5 UTSW 18 77959037 missense possibly damaging 0.78
X0023:Epg5 UTSW 18 77968657 missense probably damaging 0.99
X0060:Epg5 UTSW 18 77962485 missense possibly damaging 0.94
Z1088:Epg5 UTSW 18 77959139 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTCTCGGTACAGAGCATCTATGG -3'
(R):5'- AACTAACGGACCAGTGAAGC -3'

Sequencing Primer
(F):5'- TATGGCAAAGCATACCTCTCTC -3'
(R):5'- TGCTTCTAACAGCATGACTCAC -3'
Posted On2018-04-02