Incidental Mutation 'R6322:4932414N04Rik'
ID510136
Institutional Source Beutler Lab
Gene Symbol 4932414N04Rik
Ensembl Gene ENSMUSG00000079324
Gene NameRIKEN cDNA 4932414N04 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R6322 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location68656486-68748467 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 68729499 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 211 (V211A)
Ref Sequence ENSEMBL: ENSMUSP00000135792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055930] [ENSMUST00000128259]
Predicted Effect probably benign
Transcript: ENSMUST00000055930
AA Change: V211A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000059809
Gene: ENSMUSG00000079324
AA Change: V211A

DomainStartEndE-ValueType
coiled coil region 154 241 N/A INTRINSIC
Pfam:DUF3496 265 361 8.5e-12 PFAM
internal_repeat_1 456 597 1.76e-26 PROSPERO
internal_repeat_1 601 737 1.76e-26 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000128259
AA Change: V211A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000135792
Gene: ENSMUSG00000079324
AA Change: V211A

DomainStartEndE-ValueType
internal_repeat_1 5 39 6.02e-5 PROSPERO
internal_repeat_1 209 242 6.02e-5 PROSPERO
low complexity region 286 297 N/A INTRINSIC
Meta Mutation Damage Score 0.1324 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adora3 G A 3: 105,907,444 R170H probably benign Het
Aldh1l1 T C 6: 90,562,698 I203T probably benign Het
Alox12b T C 11: 69,158,373 Y83H possibly damaging Het
Atcay A T 10: 81,213,291 I159K probably damaging Het
Blvra A G 2: 127,080,539 probably benign Het
Celsr2 A G 3: 108,412,574 F974S probably damaging Het
Cfap44 C T 16: 44,433,666 R918* probably null Het
Cpa6 T A 1: 10,477,121 R181S possibly damaging Het
Dlg1 A G 16: 31,856,479 N730D probably damaging Het
Eif2ak1 A G 5: 143,899,095 T535A probably benign Het
Fam13c A T 10: 70,498,891 D149V probably damaging Het
Fam171a1 G A 2: 3,226,355 V717I probably benign Het
Fchsd1 A G 18: 37,965,700 V290A probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm15446 A T 5: 109,943,517 H545L probably damaging Het
Gm16432 T A 1: 178,017,730 Y105* probably null Het
Heatr9 T G 11: 83,516,712 K215T possibly damaging Het
Hfe T A 13: 23,705,896 H210L probably damaging Het
Lama2 T C 10: 27,190,547 T1113A probably damaging Het
Lipe A T 7: 25,380,536 V686E probably damaging Het
Map3k20 T G 2: 72,433,470 L488V possibly damaging Het
Moxd1 C T 10: 24,284,811 T454I probably damaging Het
Mrpl58 C T 11: 115,410,666 R189* probably null Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nkx1-1 T C 5: 33,431,045 N300D probably damaging Het
Nrm A T 17: 35,864,713 Q237L possibly damaging Het
Numa1 T C 7: 102,000,920 L1286P probably damaging Het
Olfr1291-ps1 T C 2: 111,499,384 F44S possibly damaging Het
Pappa C A 4: 65,314,659 A1345D probably damaging Het
Pds5a T C 5: 65,696,834 I22V probably benign Het
Phf21b C A 15: 84,787,379 R438L possibly damaging Het
Pik3r5 T C 11: 68,492,741 L462P probably benign Het
Plagl2 T C 2: 153,231,886 E365G probably benign Het
Plxna2 A G 1: 194,754,367 Y677C possibly damaging Het
Pramef12 A G 4: 144,392,905 M364T probably benign Het
Prkcd C A 14: 30,599,663 G410W probably damaging Het
Rgl1 T C 1: 152,552,435 I348V probably damaging Het
Rnmt C T 18: 68,319,214 P386S probably damaging Het
Rtn3 G A 19: 7,458,138 P163L possibly damaging Het
Sfxn1 T C 13: 54,104,850 C275R possibly damaging Het
Sh2b2 A G 5: 136,224,188 S377P probably damaging Het
Sh3bp1 C T 15: 78,911,515 P615S probably damaging Het
Simc1 T C 13: 54,550,569 L1334S probably damaging Het
Slc9a2 C A 1: 40,742,653 Y347* probably null Het
Snapc5 T A 9: 64,182,173 I71K probably damaging Het
Tmem161a T C 8: 70,182,114 F447S probably damaging Het
Tns3 A G 11: 8,492,147 C739R probably benign Het
Trappc11 A T 8: 47,530,773 V28D possibly damaging Het
Ubr3 C T 2: 69,956,085 Q848* probably null Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Other mutations in 4932414N04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:4932414N04Rik APN 2 68732875 missense probably benign 0.02
IGL01384:4932414N04Rik APN 2 68745405 missense possibly damaging 0.53
IGL02170:4932414N04Rik APN 2 68731123 missense probably benign 0.02
IGL02650:4932414N04Rik APN 2 68741537 missense probably benign 0.00
IGL02707:4932414N04Rik APN 2 68731130 missense possibly damaging 0.71
IGL02737:4932414N04Rik APN 2 68736560 missense possibly damaging 0.53
IGL03351:4932414N04Rik APN 2 68731083 missense probably benign
R0328:4932414N04Rik UTSW 2 68744280 missense possibly damaging 0.53
R0362:4932414N04Rik UTSW 2 68732917 missense probably benign 0.00
R0638:4932414N04Rik UTSW 2 68717228 missense probably benign 0.18
R1201:4932414N04Rik UTSW 2 68716282 missense possibly damaging 0.53
R1381:4932414N04Rik UTSW 2 68731086 missense probably benign 0.18
R1456:4932414N04Rik UTSW 2 68716214 missense possibly damaging 0.86
R2001:4932414N04Rik UTSW 2 68741456 missense probably benign
R2051:4932414N04Rik UTSW 2 68711048 missense possibly damaging 0.72
R2228:4932414N04Rik UTSW 2 68729591 missense probably benign 0.00
R2292:4932414N04Rik UTSW 2 68732139 missense probably benign 0.00
R2357:4932414N04Rik UTSW 2 68739500 missense possibly damaging 0.86
R2484:4932414N04Rik UTSW 2 68711475 missense possibly damaging 0.85
R3035:4932414N04Rik UTSW 2 68745418 missense probably benign 0.00
R3916:4932414N04Rik UTSW 2 68731985 missense possibly damaging 0.71
R3950:4932414N04Rik UTSW 2 68664403 critical splice donor site probably null
R3951:4932414N04Rik UTSW 2 68664403 critical splice donor site probably null
R3952:4932414N04Rik UTSW 2 68664403 critical splice donor site probably null
R4091:4932414N04Rik UTSW 2 68745378 missense possibly damaging 0.73
R4118:4932414N04Rik UTSW 2 68736513 missense probably benign
R4153:4932414N04Rik UTSW 2 68668597 intron probably benign
R4210:4932414N04Rik UTSW 2 68659878 start gained probably benign
R4614:4932414N04Rik UTSW 2 68745460 missense probably benign 0.01
R4818:4932414N04Rik UTSW 2 68741466 missense probably benign
R5202:4932414N04Rik UTSW 2 68731964 missense probably benign
R5466:4932414N04Rik UTSW 2 68711389 missense probably benign 0.11
R5585:4932414N04Rik UTSW 2 68741426 missense probably benign 0.00
R5602:4932414N04Rik UTSW 2 68748368 makesense probably null
R5846:4932414N04Rik UTSW 2 68732033 missense unknown
R5902:4932414N04Rik UTSW 2 68708937 start codon destroyed probably null
R6002:4932414N04Rik UTSW 2 68662424 splice site probably null
R6029:4932414N04Rik UTSW 2 68694026 splice site probably null
R6093:4932414N04Rik UTSW 2 68659870 splice site probably benign
R6168:4932414N04Rik UTSW 2 68741483 missense possibly damaging 0.86
R6300:4932414N04Rik UTSW 2 68731109 missense possibly damaging 0.96
R6533:4932414N04Rik UTSW 2 68716318 nonsense probably null
R6547:4932414N04Rik UTSW 2 68659907 utr 5 prime probably benign
X0025:4932414N04Rik UTSW 2 68729016 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CCGGACCGAGATGTAAATGAGATTC -3'
(R):5'- AAGACTGGCACTAGTGGTTG -3'

Sequencing Primer
(F):5'- CATTTACCAAATCACCTACTTTCCAG -3'
(R):5'- CCATAAGAATTCTATTGGTGCCTAC -3'
Posted On2018-04-02