Incidental Mutation 'R6322:Map3k20'
ID510138
Institutional Source Beutler Lab
Gene Symbol Map3k20
Ensembl Gene ENSMUSG00000004085
Gene Namemitogen-activated protein kinase kinase kinase 20
SynonymsMLTKalpha, Zak, MLTKbeta, B230120H23Rik
Accession Numbers

Genbank: NM_023057, NM_178084; MGI: 2443258

Is this an essential gene? Possibly essential (E-score: 0.704) question?
Stock #R6322 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location72285637-72442610 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 72433470 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Valine at position 488 (L488V)
Ref Sequence ENSEMBL: ENSMUSP00000088334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090824]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090824
AA Change: L488V

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000088334
Gene: ENSMUSG00000004085
AA Change: L488V

DomainStartEndE-ValueType
Pfam:Pkinase 16 259 6.3e-56 PFAM
Pfam:Pkinase_Tyr 16 260 9.9e-64 PFAM
coiled coil region 277 328 N/A INTRINSIC
SAM 336 410 5.59e-7 SMART
low complexity region 643 668 N/A INTRINSIC
Meta Mutation Damage Score 0.094 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MAPKKK family of signal transduction molecules and encodes a protein with an N-terminal kinase catalytic domain, followed by a leucine zipper motif and a sterile-alpha motif (SAM). This magnesium-binding protein forms homodimers and is located in the cytoplasm. The protein mediates gamma radiation signaling leading to cell cycle arrest and activity of this protein plays a role in cell cycle checkpoint regulation in cells. The protein also has pro-apoptotic activity. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete lethality at E9.5 with growth retardation. Mice homozygous for an allele lacking the SAM domain exhibit low penetrant unilateral complex hindlimb duplication phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,729,499 V211A probably benign Het
Adora3 G A 3: 105,907,444 R170H probably benign Het
Aldh1l1 T C 6: 90,562,698 I203T probably benign Het
Alox12b T C 11: 69,158,373 Y83H possibly damaging Het
Atcay A T 10: 81,213,291 I159K probably damaging Het
Blvra A G 2: 127,080,539 probably benign Het
Celsr2 A G 3: 108,412,574 F974S probably damaging Het
Cfap44 C T 16: 44,433,666 R918* probably null Het
Cpa6 T A 1: 10,477,121 R181S possibly damaging Het
Dlg1 A G 16: 31,856,479 N730D probably damaging Het
Eif2ak1 A G 5: 143,899,095 T535A probably benign Het
Fam13c A T 10: 70,498,891 D149V probably damaging Het
Fam171a1 G A 2: 3,226,355 V717I probably benign Het
Fchsd1 A G 18: 37,965,700 V290A probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm15446 A T 5: 109,943,517 H545L probably damaging Het
Gm16432 T A 1: 178,017,730 Y105* probably null Het
Heatr9 T G 11: 83,516,712 K215T possibly damaging Het
Hfe T A 13: 23,705,896 H210L probably damaging Het
Lama2 T C 10: 27,190,547 T1113A probably damaging Het
Lipe A T 7: 25,380,536 V686E probably damaging Het
Moxd1 C T 10: 24,284,811 T454I probably damaging Het
Mrpl58 C T 11: 115,410,666 R189* probably null Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nkx1-1 T C 5: 33,431,045 N300D probably damaging Het
Nrm A T 17: 35,864,713 Q237L possibly damaging Het
Numa1 T C 7: 102,000,920 L1286P probably damaging Het
Olfr1291-ps1 T C 2: 111,499,384 F44S possibly damaging Het
Pappa C A 4: 65,314,659 A1345D probably damaging Het
Pds5a T C 5: 65,696,834 I22V probably benign Het
Phf21b C A 15: 84,787,379 R438L possibly damaging Het
Pik3r5 T C 11: 68,492,741 L462P probably benign Het
Plagl2 T C 2: 153,231,886 E365G probably benign Het
Plxna2 A G 1: 194,754,367 Y677C possibly damaging Het
Pramef12 A G 4: 144,392,905 M364T probably benign Het
Prkcd C A 14: 30,599,663 G410W probably damaging Het
Rgl1 T C 1: 152,552,435 I348V probably damaging Het
Rnmt C T 18: 68,319,214 P386S probably damaging Het
Rtn3 G A 19: 7,458,138 P163L possibly damaging Het
Sfxn1 T C 13: 54,104,850 C275R possibly damaging Het
Sh2b2 A G 5: 136,224,188 S377P probably damaging Het
Sh3bp1 C T 15: 78,911,515 P615S probably damaging Het
Simc1 T C 13: 54,550,569 L1334S probably damaging Het
Slc9a2 C A 1: 40,742,653 Y347* probably null Het
Snapc5 T A 9: 64,182,173 I71K probably damaging Het
Tmem161a T C 8: 70,182,114 F447S probably damaging Het
Tns3 A G 11: 8,492,147 C739R probably benign Het
Trappc11 A T 8: 47,530,773 V28D possibly damaging Het
Ubr3 C T 2: 69,956,085 Q848* probably null Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Other mutations in Map3k20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Map3k20 APN 2 72412170 missense probably damaging 1.00
IGL00333:Map3k20 APN 2 72371976 missense probably damaging 0.99
IGL00505:Map3k20 APN 2 72389483 missense probably damaging 1.00
IGL01472:Map3k20 APN 2 72355553 splice site probably benign
IGL01982:Map3k20 APN 2 72298333 nonsense probably null
IGL02556:Map3k20 APN 2 72371895 missense probably damaging 0.98
IGL02831:Map3k20 APN 2 72371727 missense probably damaging 1.00
3-1:Map3k20 UTSW 2 72412125 missense probably damaging 1.00
R0765:Map3k20 UTSW 2 72371925 missense probably damaging 1.00
R1160:Map3k20 UTSW 2 72441520 missense probably benign 0.01
R1195:Map3k20 UTSW 2 72438218 missense probably damaging 1.00
R1195:Map3k20 UTSW 2 72438218 missense probably damaging 1.00
R1195:Map3k20 UTSW 2 72438218 missense probably damaging 1.00
R1406:Map3k20 UTSW 2 72389494 missense probably damaging 0.99
R1406:Map3k20 UTSW 2 72389494 missense probably damaging 0.99
R1509:Map3k20 UTSW 2 72364624 splice site probably benign
R1634:Map3k20 UTSW 2 72410177 nonsense probably null
R1723:Map3k20 UTSW 2 72389492 missense probably damaging 1.00
R1986:Map3k20 UTSW 2 72441294 nonsense probably null
R2014:Map3k20 UTSW 2 72438260 missense probably benign 0.00
R2086:Map3k20 UTSW 2 72398385 missense probably benign 0.01
R2311:Map3k20 UTSW 2 72368440 missense probably damaging 1.00
R2655:Map3k20 UTSW 2 72433420 missense probably damaging 1.00
R3150:Map3k20 UTSW 2 72371992 missense probably damaging 1.00
R3781:Map3k20 UTSW 2 72402355 intron probably benign
R3950:Map3k20 UTSW 2 72438300 missense probably damaging 0.99
R3951:Map3k20 UTSW 2 72438300 missense probably damaging 0.99
R3952:Map3k20 UTSW 2 72438300 missense probably damaging 0.99
R3981:Map3k20 UTSW 2 72438227 missense probably damaging 0.99
R3982:Map3k20 UTSW 2 72438227 missense probably damaging 0.99
R3983:Map3k20 UTSW 2 72438227 missense probably damaging 0.99
R4011:Map3k20 UTSW 2 72384124 splice site probably benign
R4180:Map3k20 UTSW 2 72441571 missense probably damaging 0.97
R4790:Map3k20 UTSW 2 72441704 missense probably benign
R4895:Map3k20 UTSW 2 72402356 intron probably benign
R4943:Map3k20 UTSW 2 72371918 missense possibly damaging 0.90
R4983:Map3k20 UTSW 2 72402067 missense probably benign 0.00
R5023:Map3k20 UTSW 2 72402345 intron probably benign
R5157:Map3k20 UTSW 2 72438214 missense probably benign 0.00
R5703:Map3k20 UTSW 2 72402170 missense probably benign 0.00
R6134:Map3k20 UTSW 2 72410159 missense probably damaging 0.99
R6418:Map3k20 UTSW 2 72402113 missense probably benign 0.15
R6449:Map3k20 UTSW 2 72398414 missense probably damaging 1.00
R6495:Map3k20 UTSW 2 72368419 missense probably damaging 1.00
R6508:Map3k20 UTSW 2 72441909 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AAATAAGGCGCTCCCACATG -3'
(R):5'- TCCTTCTAACACTGAAGAGCTC -3'

Sequencing Primer
(F):5'- TAAGGCGCTCCCACATGACTTC -3'
(R):5'- CACTGCTGCGGTATTCT -3'
Posted On2018-04-02