Incidental Mutation 'R6322:Cfap44'
ID510176
Institutional Source Beutler Lab
Gene Symbol Cfap44
Ensembl Gene ENSMUSG00000071550
Gene Namecilia and flagella associated protein 44
Synonyms6330444M21Rik, D16Ertd642e, Wdr52
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6322 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location44394796-44482428 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 44433666 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 918 (R918*)
Ref Sequence ENSEMBL: ENSMUSP00000113908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099742] [ENSMUST00000120049]
Predicted Effect probably null
Transcript: ENSMUST00000099742
AA Change: R918*
SMART Domains Protein: ENSMUSP00000097331
Gene: ENSMUSG00000071550
AA Change: R918*

DomainStartEndE-ValueType
low complexity region 42 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
Blast:WD40 161 201 1e-7 BLAST
WD40 204 246 4.58e1 SMART
WD40 249 288 4.62e-1 SMART
Blast:WD40 292 337 2e-15 BLAST
WD40 342 381 4.8e-2 SMART
WD40 447 486 4.95e-4 SMART
WD40 491 532 2.64e2 SMART
WD40 552 591 2.98e-7 SMART
Blast:WD40 595 634 1e-19 BLAST
coiled coil region 669 711 N/A INTRINSIC
WD40 780 820 3.82e1 SMART
WD40 830 872 2.4e-2 SMART
coiled coil region 907 955 N/A INTRINSIC
coiled coil region 1101 1122 N/A INTRINSIC
low complexity region 1266 1295 N/A INTRINSIC
low complexity region 1312 1325 N/A INTRINSIC
coiled coil region 1402 1459 N/A INTRINSIC
low complexity region 1476 1488 N/A INTRINSIC
low complexity region 1489 1523 N/A INTRINSIC
coiled coil region 1543 1607 N/A INTRINSIC
coiled coil region 1630 1731 N/A INTRINSIC
coiled coil region 1795 1822 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000120049
AA Change: R918*
SMART Domains Protein: ENSMUSP00000113908
Gene: ENSMUSG00000071550
AA Change: R918*

DomainStartEndE-ValueType
low complexity region 42 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
Blast:WD40 161 201 1e-7 BLAST
WD40 204 246 4.58e1 SMART
WD40 249 288 4.62e-1 SMART
Blast:WD40 292 337 2e-15 BLAST
WD40 342 381 4.8e-2 SMART
WD40 447 486 4.95e-4 SMART
WD40 491 532 2.64e2 SMART
WD40 552 591 2.98e-7 SMART
Blast:WD40 595 634 1e-19 BLAST
coiled coil region 669 711 N/A INTRINSIC
WD40 780 820 3.82e1 SMART
WD40 830 872 2.4e-2 SMART
coiled coil region 907 955 N/A INTRINSIC
coiled coil region 1101 1122 N/A INTRINSIC
low complexity region 1266 1295 N/A INTRINSIC
low complexity region 1312 1325 N/A INTRINSIC
coiled coil region 1402 1459 N/A INTRINSIC
low complexity region 1476 1488 N/A INTRINSIC
low complexity region 1489 1523 N/A INTRINSIC
coiled coil region 1543 1607 N/A INTRINSIC
coiled coil region 1630 1731 N/A INTRINSIC
coiled coil region 1795 1822 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128916
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142648
Meta Mutation Damage Score 0.6272 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 98% (51/52)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete male sterility, asthenozoospermia, and teratozoospermia characterized by multiple sperm axonemal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,729,499 V211A probably benign Het
Adora3 G A 3: 105,907,444 R170H probably benign Het
Aldh1l1 T C 6: 90,562,698 I203T probably benign Het
Alox12b T C 11: 69,158,373 Y83H possibly damaging Het
Atcay A T 10: 81,213,291 I159K probably damaging Het
Blvra A G 2: 127,080,539 probably benign Het
Celsr2 A G 3: 108,412,574 F974S probably damaging Het
Cpa6 T A 1: 10,477,121 R181S possibly damaging Het
Dlg1 A G 16: 31,856,479 N730D probably damaging Het
Eif2ak1 A G 5: 143,899,095 T535A probably benign Het
Fam13c A T 10: 70,498,891 D149V probably damaging Het
Fam171a1 G A 2: 3,226,355 V717I probably benign Het
Fchsd1 A G 18: 37,965,700 V290A probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm15446 A T 5: 109,943,517 H545L probably damaging Het
Gm16432 T A 1: 178,017,730 Y105* probably null Het
Heatr9 T G 11: 83,516,712 K215T possibly damaging Het
Hfe T A 13: 23,705,896 H210L probably damaging Het
Lama2 T C 10: 27,190,547 T1113A probably damaging Het
Lipe A T 7: 25,380,536 V686E probably damaging Het
Map3k20 T G 2: 72,433,470 L488V possibly damaging Het
Moxd1 C T 10: 24,284,811 T454I probably damaging Het
Mrpl58 C T 11: 115,410,666 R189* probably null Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nkx1-1 T C 5: 33,431,045 N300D probably damaging Het
Nrm A T 17: 35,864,713 Q237L possibly damaging Het
Numa1 T C 7: 102,000,920 L1286P probably damaging Het
Olfr1291-ps1 T C 2: 111,499,384 F44S possibly damaging Het
Pappa C A 4: 65,314,659 A1345D probably damaging Het
Pds5a T C 5: 65,696,834 I22V probably benign Het
Phf21b C A 15: 84,787,379 R438L possibly damaging Het
Pik3r5 T C 11: 68,492,741 L462P probably benign Het
Plagl2 T C 2: 153,231,886 E365G probably benign Het
Plxna2 A G 1: 194,754,367 Y677C possibly damaging Het
Pramef12 A G 4: 144,392,905 M364T probably benign Het
Prkcd C A 14: 30,599,663 G410W probably damaging Het
Rgl1 T C 1: 152,552,435 I348V probably damaging Het
Rnmt C T 18: 68,319,214 P386S probably damaging Het
Rtn3 G A 19: 7,458,138 P163L possibly damaging Het
Sfxn1 T C 13: 54,104,850 C275R possibly damaging Het
Sh2b2 A G 5: 136,224,188 S377P probably damaging Het
Sh3bp1 C T 15: 78,911,515 P615S probably damaging Het
Simc1 T C 13: 54,550,569 L1334S probably damaging Het
Slc9a2 C A 1: 40,742,653 Y347* probably null Het
Snapc5 T A 9: 64,182,173 I71K probably damaging Het
Tmem161a T C 8: 70,182,114 F447S probably damaging Het
Tns3 A G 11: 8,492,147 C739R probably benign Het
Trappc11 A T 8: 47,530,773 V28D possibly damaging Het
Ubr3 C T 2: 69,956,085 Q848* probably null Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Other mutations in Cfap44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Cfap44 APN 16 44407404 missense probably damaging 0.99
IGL00952:Cfap44 APN 16 44421275 missense probably benign 0.33
IGL01340:Cfap44 APN 16 44404130 missense probably damaging 1.00
IGL01530:Cfap44 APN 16 44449167 missense probably damaging 1.00
IGL02083:Cfap44 APN 16 44437162 missense probably damaging 1.00
IGL02088:Cfap44 APN 16 44451628 missense possibly damaging 0.59
IGL02142:Cfap44 APN 16 44421144 missense probably benign 0.15
IGL02311:Cfap44 APN 16 44404771 splice site probably benign
IGL02574:Cfap44 APN 16 44481383 missense probably damaging 1.00
IGL02893:Cfap44 APN 16 44416817 missense probably damaging 1.00
IGL02959:Cfap44 APN 16 44470867 splice site probably benign
IGL03291:Cfap44 APN 16 44407311 missense possibly damaging 0.86
feldgrau UTSW 16 44433666 nonsense probably null
I2288:Cfap44 UTSW 16 44449138 nonsense probably null
R0023:Cfap44 UTSW 16 44421220 missense probably benign 0.01
R0023:Cfap44 UTSW 16 44421220 missense probably benign 0.01
R0036:Cfap44 UTSW 16 44439069 missense possibly damaging 0.83
R0139:Cfap44 UTSW 16 44433422 missense possibly damaging 0.90
R0145:Cfap44 UTSW 16 44468372 missense probably damaging 1.00
R0193:Cfap44 UTSW 16 44449210 splice site probably null
R0238:Cfap44 UTSW 16 44422318 missense probably benign
R0238:Cfap44 UTSW 16 44422318 missense probably benign
R0288:Cfap44 UTSW 16 44415894 splice site probably benign
R0367:Cfap44 UTSW 16 44433476 critical splice donor site probably null
R0452:Cfap44 UTSW 16 44431945 missense probably benign 0.01
R0531:Cfap44 UTSW 16 44401426 start codon destroyed probably benign 0.01
R0722:Cfap44 UTSW 16 44404676 missense possibly damaging 0.94
R0801:Cfap44 UTSW 16 44422486 missense probably benign 0.41
R1209:Cfap44 UTSW 16 44422417 missense possibly damaging 0.86
R1215:Cfap44 UTSW 16 44419303 missense probably damaging 1.00
R1385:Cfap44 UTSW 16 44470775 missense probably damaging 1.00
R1400:Cfap44 UTSW 16 44421212 missense probably benign 0.01
R1415:Cfap44 UTSW 16 44481389 missense probably damaging 0.99
R1475:Cfap44 UTSW 16 44433812 splice site probably benign
R1901:Cfap44 UTSW 16 44422374 missense probably benign 0.00
R1902:Cfap44 UTSW 16 44422374 missense probably benign 0.00
R1903:Cfap44 UTSW 16 44422374 missense probably benign 0.00
R2023:Cfap44 UTSW 16 44416012 missense probably benign 0.01
R2126:Cfap44 UTSW 16 44410475 missense probably benign 0.40
R2147:Cfap44 UTSW 16 44451684 missense probably benign 0.31
R2233:Cfap44 UTSW 16 44451525 missense probably benign 0.01
R2439:Cfap44 UTSW 16 44481246 unclassified probably benign
R3015:Cfap44 UTSW 16 44410469 missense probably benign 0.40
R4178:Cfap44 UTSW 16 44451853 missense possibly damaging 0.81
R4421:Cfap44 UTSW 16 44422437 missense probably damaging 1.00
R4516:Cfap44 UTSW 16 44473864 nonsense probably null
R4742:Cfap44 UTSW 16 44449252 intron probably null
R4766:Cfap44 UTSW 16 44415883 splice site probably null
R4810:Cfap44 UTSW 16 44451535 missense probably damaging 0.99
R4955:Cfap44 UTSW 16 44475277 missense possibly damaging 0.75
R5058:Cfap44 UTSW 16 44420204 splice site probably null
R5164:Cfap44 UTSW 16 44481389 missense probably damaging 0.99
R5172:Cfap44 UTSW 16 44449193 missense probably benign
R5344:Cfap44 UTSW 16 44416400 critical splice donor site probably null
R5519:Cfap44 UTSW 16 44404088 missense probably damaging 1.00
R5572:Cfap44 UTSW 16 44481305 missense possibly damaging 0.95
R5601:Cfap44 UTSW 16 44460186 missense probably damaging 1.00
R5625:Cfap44 UTSW 16 44460347 unclassified probably null
R5638:Cfap44 UTSW 16 44455531 missense possibly damaging 0.94
R5727:Cfap44 UTSW 16 44435442 missense probably damaging 0.98
R5950:Cfap44 UTSW 16 44479847 missense probably damaging 0.99
R6057:Cfap44 UTSW 16 44449097 missense probably benign 0.03
R6063:Cfap44 UTSW 16 44429892 missense probably benign 0.00
R6221:Cfap44 UTSW 16 44437186 missense probably benign 0.13
R6277:Cfap44 UTSW 16 44437306 missense probably benign 0.04
R6836:Cfap44 UTSW 16 44404079 missense probably damaging 0.99
R6854:Cfap44 UTSW 16 44449028 critical splice acceptor site probably null
R6889:Cfap44 UTSW 16 44404132 missense probably benign 0.03
R7233:Cfap44 UTSW 16 44422408 missense probably damaging 0.99
R7298:Cfap44 UTSW 16 44481412 missense probably benign 0.04
R7332:Cfap44 UTSW 16 44429828 missense probably damaging 1.00
R7410:Cfap44 UTSW 16 44468413 missense probably damaging 1.00
R7456:Cfap44 UTSW 16 44431942 missense probably benign 0.07
R7491:Cfap44 UTSW 16 44470748 missense probably damaging 1.00
V1662:Cfap44 UTSW 16 44449138 nonsense probably null
X0060:Cfap44 UTSW 16 44449074 missense possibly damaging 0.83
Z1088:Cfap44 UTSW 16 44401466 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGTGATCAGGCCCAAGCTTC -3'
(R):5'- GGACACATGATTTTCCCATATCGTC -3'

Sequencing Primer
(F):5'- TCCTTCCAAACAAACCGACTTTTGG -3'
(R):5'- TCGTTGCCAAATAGGAGTCC -3'
Posted On2018-04-02