Incidental Mutation 'R6323:Zfp593'
ID510192
Institutional Source Beutler Lab
Gene Symbol Zfp593
Ensembl Gene ENSMUSG00000028840
Gene Namezinc finger protein 593
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.362) question?
Stock #R6323 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location134243289-134245592 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 134244913 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 94 (V94A)
Ref Sequence ENSEMBL: ENSMUSP00000030644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030644] [ENSMUST00000122952] [ENSMUST00000124452] [ENSMUST00000125921] [ENSMUST00000131447] [ENSMUST00000135228] [ENSMUST00000143448] [ENSMUST00000144222] [ENSMUST00000205501]
Predicted Effect probably benign
Transcript: ENSMUST00000030644
AA Change: V94A

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000030644
Gene: ENSMUSG00000028840
AA Change: V94A

DomainStartEndE-ValueType
low complexity region 40 60 N/A INTRINSIC
ZnF_C2H2 61 85 6.4e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122952
Predicted Effect probably benign
Transcript: ENSMUST00000124452
Predicted Effect probably benign
Transcript: ENSMUST00000125921
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129183
Predicted Effect probably benign
Transcript: ENSMUST00000131447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134320
Predicted Effect probably benign
Transcript: ENSMUST00000135228
Predicted Effect probably benign
Transcript: ENSMUST00000143448
Predicted Effect probably benign
Transcript: ENSMUST00000144222
Predicted Effect probably benign
Transcript: ENSMUST00000205501
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik G A 10: 82,283,082 T4698I probably benign Het
4933409G03Rik A G 2: 68,606,224 T171A unknown Het
Akr1c6 A G 13: 4,447,018 K153R possibly damaging Het
Ano1 T A 7: 144,611,686 I601F possibly damaging Het
Arfgef2 A G 2: 166,834,484 Y8C probably damaging Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
Baz2a A G 10: 128,126,417 I1816V probably benign Het
Cadps2 T A 6: 23,263,578 T1294S probably benign Het
Casz1 T C 4: 148,941,704 S952P possibly damaging Het
Cdc20 T C 4: 118,435,564 N329S probably damaging Het
Ceacam1 A C 7: 25,474,651 L193R probably damaging Het
Celf5 A G 10: 81,469,503 S143P probably damaging Het
Cfap74 A G 4: 155,463,938 D1342G possibly damaging Het
Chd5 C A 4: 152,367,334 T701K probably damaging Het
Cpt1b C A 15: 89,419,063 M596I probably benign Het
Ctrb1 A G 8: 111,689,591 V21A probably benign Het
Diaph3 C T 14: 86,966,453 V579I probably benign Het
Dlc1 T C 8: 36,938,383 E84G possibly damaging Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Galns T C 8: 122,598,651 D254G probably damaging Het
Gpn3 C T 5: 122,372,575 probably benign Het
Gstm1 A G 3: 108,017,747 V10A probably benign Het
Krt13 C A 11: 100,121,150 A116S probably damaging Het
Lars2 A T 9: 123,441,594 K584* probably null Het
Lrrc43 G T 5: 123,503,886 G600W probably damaging Het
Madd G T 2: 91,161,438 probably null Het
Mnat1 A G 12: 73,168,104 D65G probably damaging Het
Nsmf A G 2: 25,055,051 N42S possibly damaging Het
Olfr1283 T C 2: 111,368,701 L23P possibly damaging Het
Olfr198 A G 16: 59,202,282 L48P probably damaging Het
Palld A T 8: 61,720,693 W311R probably damaging Het
Pax1 T A 2: 147,368,401 V352E probably damaging Het
Rnf2 T C 1: 151,473,216 K51R probably damaging Het
Rpl7l1 C A 17: 46,782,638 probably benign Het
Slc17a2 A G 13: 23,814,986 I121V probably benign Het
Slc1a6 G A 10: 78,812,887 G481S probably damaging Het
Trav6-1 T C 14: 52,638,791 V56A possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r79 T A 7: 87,001,314 C103S probably benign Het
Wwp2 A T 8: 107,540,671 H305L probably damaging Het
Other mutations in Zfp593
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01745:Zfp593 APN 4 134245044 missense probably damaging 1.00
R0885:Zfp593 UTSW 4 134244913 missense probably benign 0.11
R1818:Zfp593 UTSW 4 134245083 unclassified probably null
R1986:Zfp593 UTSW 4 134244895 missense possibly damaging 0.94
R2570:Zfp593 UTSW 4 134245558 unclassified probably benign
R4349:Zfp593 UTSW 4 134245056 missense probably benign 0.25
R4740:Zfp593 UTSW 4 134244766 unclassified probably benign
R5393:Zfp593 UTSW 4 134245304 missense probably benign 0.00
Z1088:Zfp593 UTSW 4 134245442 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGGCTGATGAACCACTGC -3'
(R):5'- ATGTCTGGGAACGAGCTAGG -3'

Sequencing Primer
(F):5'- TGATGAACCACTGCCCATGG -3'
(R):5'- CTACATTCCTGCAGGAGGTAC -3'
Posted On2018-04-02