Incidental Mutation 'R6323:Vmn2r79'
ID510200
Institutional Source Beutler Lab
Gene Symbol Vmn2r79
Ensembl Gene ENSMUSG00000090362
Gene Namevomeronasal 2, receptor 79
SynonymsEG621430
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R6323 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location86996465-87037968 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87001314 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 103 (C103S)
Ref Sequence ENSEMBL: ENSMUSP00000132478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164462]
Predicted Effect probably benign
Transcript: ENSMUST00000164462
AA Change: C103S

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000132478
Gene: ENSMUSG00000090362
AA Change: C103S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 75 464 1.9e-31 PFAM
Pfam:NCD3G 506 559 3.1e-21 PFAM
Pfam:7tm_3 592 827 2.8e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik G A 10: 82,283,082 T4698I probably benign Het
4933409G03Rik A G 2: 68,606,224 T171A unknown Het
Akr1c6 A G 13: 4,447,018 K153R possibly damaging Het
Ano1 T A 7: 144,611,686 I601F possibly damaging Het
Arfgef2 A G 2: 166,834,484 Y8C probably damaging Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
Baz2a A G 10: 128,126,417 I1816V probably benign Het
Cadps2 T A 6: 23,263,578 T1294S probably benign Het
Casz1 T C 4: 148,941,704 S952P possibly damaging Het
Cdc20 T C 4: 118,435,564 N329S probably damaging Het
Ceacam1 A C 7: 25,474,651 L193R probably damaging Het
Celf5 A G 10: 81,469,503 S143P probably damaging Het
Cfap74 A G 4: 155,463,938 D1342G possibly damaging Het
Chd5 C A 4: 152,367,334 T701K probably damaging Het
Cpt1b C A 15: 89,419,063 M596I probably benign Het
Ctrb1 A G 8: 111,689,591 V21A probably benign Het
Diaph3 C T 14: 86,966,453 V579I probably benign Het
Dlc1 T C 8: 36,938,383 E84G possibly damaging Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Galns T C 8: 122,598,651 D254G probably damaging Het
Gpn3 C T 5: 122,372,575 probably benign Het
Gstm1 A G 3: 108,017,747 V10A probably benign Het
Krt13 C A 11: 100,121,150 A116S probably damaging Het
Lars2 A T 9: 123,441,594 K584* probably null Het
Lrrc43 G T 5: 123,503,886 G600W probably damaging Het
Madd G T 2: 91,161,438 probably null Het
Mnat1 A G 12: 73,168,104 D65G probably damaging Het
Nsmf A G 2: 25,055,051 N42S possibly damaging Het
Olfr1283 T C 2: 111,368,701 L23P possibly damaging Het
Olfr198 A G 16: 59,202,282 L48P probably damaging Het
Palld A T 8: 61,720,693 W311R probably damaging Het
Pax1 T A 2: 147,368,401 V352E probably damaging Het
Rnf2 T C 1: 151,473,216 K51R probably damaging Het
Rpl7l1 C A 17: 46,782,638 probably benign Het
Slc17a2 A G 13: 23,814,986 I121V probably benign Het
Slc1a6 G A 10: 78,812,887 G481S probably damaging Het
Trav6-1 T C 14: 52,638,791 V56A possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wwp2 A T 8: 107,540,671 H305L probably damaging Het
Zfp593 A G 4: 134,244,913 V94A probably benign Het
Other mutations in Vmn2r79
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01401:Vmn2r79 APN 7 87037273 missense probably benign 0.01
IGL01675:Vmn2r79 APN 7 86996648 missense probably benign 0.01
IGL01760:Vmn2r79 APN 7 87002158 missense probably benign
IGL01834:Vmn2r79 APN 7 87037146 missense probably benign 0.01
IGL01843:Vmn2r79 APN 7 87037277 missense probably damaging 1.00
IGL01914:Vmn2r79 APN 7 87037363 missense probably benign 0.14
IGL01980:Vmn2r79 APN 7 87037082 missense possibly damaging 0.49
IGL02438:Vmn2r79 APN 7 87002536 missense probably damaging 0.98
IGL02740:Vmn2r79 APN 7 87004158 missense probably benign 0.00
IGL03052:Vmn2r79 UTSW 7 87003591 missense probably benign 0.00
R0096:Vmn2r79 UTSW 7 87037319 missense probably damaging 1.00
R0096:Vmn2r79 UTSW 7 87037319 missense probably damaging 1.00
R0270:Vmn2r79 UTSW 7 87003386 missense probably benign 0.00
R0336:Vmn2r79 UTSW 7 87002079 missense probably benign 0.15
R0418:Vmn2r79 UTSW 7 87002403 missense probably benign 0.18
R1070:Vmn2r79 UTSW 7 87003473 missense probably damaging 1.00
R1234:Vmn2r79 UTSW 7 87004099 missense possibly damaging 0.71
R1459:Vmn2r79 UTSW 7 87037794 missense probably benign 0.01
R1513:Vmn2r79 UTSW 7 87037444 missense probably benign 0.01
R1624:Vmn2r79 UTSW 7 87004039 critical splice acceptor site probably null
R1633:Vmn2r79 UTSW 7 87037834 missense possibly damaging 0.52
R1676:Vmn2r79 UTSW 7 87002631 missense probably benign
R1781:Vmn2r79 UTSW 7 87002347 missense probably benign 0.00
R1794:Vmn2r79 UTSW 7 87001413 missense probably benign 0.37
R1823:Vmn2r79 UTSW 7 87037872 missense probably damaging 1.00
R2013:Vmn2r79 UTSW 7 87004081 missense possibly damaging 0.50
R2018:Vmn2r79 UTSW 7 87002426 missense probably benign 0.07
R2019:Vmn2r79 UTSW 7 87002426 missense probably benign 0.07
R2177:Vmn2r79 UTSW 7 86996631 missense possibly damaging 0.94
R2984:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R3719:Vmn2r79 UTSW 7 87002037 missense probably benign 0.05
R3798:Vmn2r79 UTSW 7 87002194 missense possibly damaging 0.88
R3969:Vmn2r79 UTSW 7 87003593 missense probably damaging 1.00
R4182:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4183:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4245:Vmn2r79 UTSW 7 87002416 missense possibly damaging 0.73
R4301:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4391:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4393:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4394:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4396:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4397:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4592:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
R4697:Vmn2r79 UTSW 7 87037960 missense probably damaging 0.98
R4897:Vmn2r79 UTSW 7 87001467 missense probably benign
R5016:Vmn2r79 UTSW 7 87037340 missense probably benign 0.00
R5058:Vmn2r79 UTSW 7 87002215 missense probably damaging 0.98
R5177:Vmn2r79 UTSW 7 87001969 missense probably damaging 0.97
R6078:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
R6079:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
R6138:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
R6257:Vmn2r79 UTSW 7 87002570 missense probably benign 0.27
R6260:Vmn2r79 UTSW 7 87037157 missense probably benign 0.00
R6307:Vmn2r79 UTSW 7 87037768 missense probably damaging 1.00
R6374:Vmn2r79 UTSW 7 87002290 missense probably benign 0.02
R6530:Vmn2r79 UTSW 7 87002044 missense possibly damaging 0.91
R6546:Vmn2r79 UTSW 7 87003533 missense probably benign 0.01
R6682:Vmn2r79 UTSW 7 87004162 missense possibly damaging 0.69
R6858:Vmn2r79 UTSW 7 87037372 missense probably benign
R6965:Vmn2r79 UTSW 7 87001892 missense probably benign 0.10
R7130:Vmn2r79 UTSW 7 87002266 missense not run
U15987:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
X0054:Vmn2r79 UTSW 7 87004062 missense probably benign 0.01
Z1088:Vmn2r79 UTSW 7 87002341 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTGTCAACATATGAATGGGTC -3'
(R):5'- CTCTGGAGTTTGGGAGAAGTAC -3'

Sequencing Primer
(F):5'- AATTCTTTGCTTAACCCACAACG -3'
(R):5'- TTTGGGAGAAGTACAGGAATGGTCC -3'
Posted On2018-04-02