Incidental Mutation 'R6323:Slc1a6'
ID510208
Institutional Source Beutler Lab
Gene Symbol Slc1a6
Ensembl Gene ENSMUSG00000005357
Gene Namesolute carrier family 1 (high affinity aspartate/glutamate transporter), member 6
SynonymsEAAT4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R6323 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location78780496-78814765 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 78812887 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 481 (G481S)
Ref Sequence ENSEMBL: ENSMUSP00000005490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005490]
Predicted Effect probably damaging
Transcript: ENSMUST00000005490
AA Change: G481S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000005490
Gene: ENSMUSG00000005357
AA Change: G481S

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:SDF 55 519 8.5e-129 PFAM
Meta Mutation Damage Score 0.498 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 98% (40/41)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene survive well and display no obvious abnormalities of behavior or brain structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik G A 10: 82,283,082 T4698I probably benign Het
4933409G03Rik A G 2: 68,606,224 T171A unknown Het
Akr1c6 A G 13: 4,447,018 K153R possibly damaging Het
Ano1 T A 7: 144,611,686 I601F possibly damaging Het
Arfgef2 A G 2: 166,834,484 Y8C probably damaging Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
Baz2a A G 10: 128,126,417 I1816V probably benign Het
Cadps2 T A 6: 23,263,578 T1294S probably benign Het
Casz1 T C 4: 148,941,704 S952P possibly damaging Het
Cdc20 T C 4: 118,435,564 N329S probably damaging Het
Ceacam1 A C 7: 25,474,651 L193R probably damaging Het
Celf5 A G 10: 81,469,503 S143P probably damaging Het
Cfap74 A G 4: 155,463,938 D1342G possibly damaging Het
Chd5 C A 4: 152,367,334 T701K probably damaging Het
Cpt1b C A 15: 89,419,063 M596I probably benign Het
Ctrb1 A G 8: 111,689,591 V21A probably benign Het
Diaph3 C T 14: 86,966,453 V579I probably benign Het
Dlc1 T C 8: 36,938,383 E84G possibly damaging Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Galns T C 8: 122,598,651 D254G probably damaging Het
Gpn3 C T 5: 122,372,575 probably benign Het
Gstm1 A G 3: 108,017,747 V10A probably benign Het
Krt13 C A 11: 100,121,150 A116S probably damaging Het
Lars2 A T 9: 123,441,594 K584* probably null Het
Lrrc43 G T 5: 123,503,886 G600W probably damaging Het
Madd G T 2: 91,161,438 probably null Het
Mnat1 A G 12: 73,168,104 D65G probably damaging Het
Nsmf A G 2: 25,055,051 N42S possibly damaging Het
Olfr1283 T C 2: 111,368,701 L23P possibly damaging Het
Olfr198 A G 16: 59,202,282 L48P probably damaging Het
Palld A T 8: 61,720,693 W311R probably damaging Het
Pax1 T A 2: 147,368,401 V352E probably damaging Het
Rnf2 T C 1: 151,473,216 K51R probably damaging Het
Rpl7l1 C A 17: 46,782,638 probably benign Het
Slc17a2 A G 13: 23,814,986 I121V probably benign Het
Trav6-1 T C 14: 52,638,791 V56A possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r79 T A 7: 87,001,314 C103S probably benign Het
Wwp2 A T 8: 107,540,671 H305L probably damaging Het
Zfp593 A G 4: 134,244,913 V94A probably benign Het
Other mutations in Slc1a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Slc1a6 APN 10 78801813 missense probably damaging 1.00
IGL00496:Slc1a6 APN 10 78793308 missense probably damaging 1.00
IGL01099:Slc1a6 APN 10 78788997 missense possibly damaging 0.67
IGL02299:Slc1a6 APN 10 78793303 missense probably damaging 1.00
IGL02677:Slc1a6 APN 10 78789064 missense probably damaging 1.00
IGL02705:Slc1a6 APN 10 78801954 missense probably damaging 1.00
IGL03024:Slc1a6 APN 10 78814608 missense probably benign
IGL03185:Slc1a6 APN 10 78801907 missense probably damaging 1.00
IGL03046:Slc1a6 UTSW 10 78800174 missense probably benign 0.19
R0183:Slc1a6 UTSW 10 78791233 missense probably damaging 1.00
R0373:Slc1a6 UTSW 10 78801922 nonsense probably null
R0730:Slc1a6 UTSW 10 78796008 missense probably benign 0.13
R0774:Slc1a6 UTSW 10 78812824 missense probably benign 0.03
R0838:Slc1a6 UTSW 10 78796222 missense probably damaging 1.00
R1449:Slc1a6 UTSW 10 78800117 missense probably damaging 0.99
R1822:Slc1a6 UTSW 10 78812931 nonsense probably null
R1853:Slc1a6 UTSW 10 78812924 missense probably damaging 0.97
R1854:Slc1a6 UTSW 10 78812924 missense probably damaging 0.97
R1855:Slc1a6 UTSW 10 78812924 missense probably damaging 0.97
R1866:Slc1a6 UTSW 10 78791349 missense probably damaging 0.99
R2073:Slc1a6 UTSW 10 78800130 missense possibly damaging 0.93
R2279:Slc1a6 UTSW 10 78789048 missense probably benign 0.12
R2360:Slc1a6 UTSW 10 78812884 missense possibly damaging 0.91
R2939:Slc1a6 UTSW 10 78814614 makesense probably null
R3111:Slc1a6 UTSW 10 78789081 missense probably damaging 0.99
R3926:Slc1a6 UTSW 10 78812881 missense possibly damaging 0.91
R4116:Slc1a6 UTSW 10 78787889 missense probably benign 0.00
R4798:Slc1a6 UTSW 10 78800118 missense probably damaging 1.00
R4916:Slc1a6 UTSW 10 78796251 missense probably damaging 1.00
R5054:Slc1a6 UTSW 10 78814602 missense probably damaging 1.00
R5166:Slc1a6 UTSW 10 78796269 critical splice donor site probably null
R5304:Slc1a6 UTSW 10 78793307 missense probably damaging 1.00
R5367:Slc1a6 UTSW 10 78787803 missense probably damaging 1.00
R5554:Slc1a6 UTSW 10 78795982 missense probably benign 0.00
R5635:Slc1a6 UTSW 10 78789091 missense possibly damaging 0.67
R5773:Slc1a6 UTSW 10 78793277 splice site probably null
R6117:Slc1a6 UTSW 10 78788988 missense possibly damaging 0.72
R6167:Slc1a6 UTSW 10 78801837 missense probably benign 0.40
R6174:Slc1a6 UTSW 10 78801907 missense probably damaging 1.00
R6221:Slc1a6 UTSW 10 78800076 missense probably damaging 0.98
R6339:Slc1a6 UTSW 10 78800085 missense possibly damaging 0.94
R6670:Slc1a6 UTSW 10 78787812 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGCATCACACATTTTGCTTTCATG -3'
(R):5'- TAACTAGAGAGCCATCCCAATG -3'

Sequencing Primer
(F):5'- CACATTTTGCTTTCATGATGTCAAC -3'
(R):5'- GAGAGCCATCCCAATGCCTCC -3'
Posted On2018-04-02