Incidental Mutation 'R6323:Celf5'
ID510209
Institutional Source Beutler Lab
Gene Symbol Celf5
Ensembl Gene ENSMUSG00000034818
Gene NameCUGBP, Elav-like family member 5
Synonyms4930565A21Rik, Brunol5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R6323 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location81459227-81482709 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81469503 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 143 (S143P)
Ref Sequence ENSEMBL: ENSMUSP00000113592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118763] [ENSMUST00000119060] [ENSMUST00000120508] [ENSMUST00000120856] [ENSMUST00000147524]
Predicted Effect probably damaging
Transcript: ENSMUST00000118763
AA Change: S144P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113675
Gene: ENSMUSG00000034818
AA Change: S144P

DomainStartEndE-ValueType
RRM 8 84 7.41e-18 SMART
RRM 97 172 3.23e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000119060
AA Change: S68P

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113546
Gene: ENSMUSG00000034818
AA Change: S68P

DomainStartEndE-ValueType
RRM 21 96 3.23e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120508
AA Change: S143P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113592
Gene: ENSMUSG00000034818
AA Change: S143P

DomainStartEndE-ValueType
RRM 8 84 7.41e-18 SMART
RRM 96 171 3.23e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120856
AA Change: S67P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113784
Gene: ENSMUSG00000034818
AA Change: S67P

DomainStartEndE-ValueType
RRM 20 95 3.23e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128494
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141207
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145375
Predicted Effect probably damaging
Transcript: ENSMUST00000147524
AA Change: S74P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117430
Gene: ENSMUSG00000034818
AA Change: S74P

DomainStartEndE-ValueType
RRM 27 92 6.87e-13 SMART
Meta Mutation Damage Score 0.158 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the the CELF/BRUNOL protein family, which contain two N-terminal RNA recognition motif (RRM) domains, one C-terminal RRM domain, and a divergent segment of 160-230 aa between the second and third RRM domains. Members of this protein family regulate pre-mRNA alternative splicing and may also be involved in mRNA editing and translation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik G A 10: 82,283,082 T4698I probably benign Het
4933409G03Rik A G 2: 68,606,224 T171A unknown Het
Akr1c6 A G 13: 4,447,018 K153R possibly damaging Het
Ano1 T A 7: 144,611,686 I601F possibly damaging Het
Arfgef2 A G 2: 166,834,484 Y8C probably damaging Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
Baz2a A G 10: 128,126,417 I1816V probably benign Het
Cadps2 T A 6: 23,263,578 T1294S probably benign Het
Casz1 T C 4: 148,941,704 S952P possibly damaging Het
Cdc20 T C 4: 118,435,564 N329S probably damaging Het
Ceacam1 A C 7: 25,474,651 L193R probably damaging Het
Cfap74 A G 4: 155,463,938 D1342G possibly damaging Het
Chd5 C A 4: 152,367,334 T701K probably damaging Het
Cpt1b C A 15: 89,419,063 M596I probably benign Het
Ctrb1 A G 8: 111,689,591 V21A probably benign Het
Diaph3 C T 14: 86,966,453 V579I probably benign Het
Dlc1 T C 8: 36,938,383 E84G possibly damaging Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Galns T C 8: 122,598,651 D254G probably damaging Het
Gpn3 C T 5: 122,372,575 probably benign Het
Gstm1 A G 3: 108,017,747 V10A probably benign Het
Krt13 C A 11: 100,121,150 A116S probably damaging Het
Lars2 A T 9: 123,441,594 K584* probably null Het
Lrrc43 G T 5: 123,503,886 G600W probably damaging Het
Madd G T 2: 91,161,438 probably null Het
Mnat1 A G 12: 73,168,104 D65G probably damaging Het
Nsmf A G 2: 25,055,051 N42S possibly damaging Het
Olfr1283 T C 2: 111,368,701 L23P possibly damaging Het
Olfr198 A G 16: 59,202,282 L48P probably damaging Het
Palld A T 8: 61,720,693 W311R probably damaging Het
Pax1 T A 2: 147,368,401 V352E probably damaging Het
Rnf2 T C 1: 151,473,216 K51R probably damaging Het
Rpl7l1 C A 17: 46,782,638 probably benign Het
Slc17a2 A G 13: 23,814,986 I121V probably benign Het
Slc1a6 G A 10: 78,812,887 G481S probably damaging Het
Trav6-1 T C 14: 52,638,791 V56A possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r79 T A 7: 87,001,314 C103S probably benign Het
Wwp2 A T 8: 107,540,671 H305L probably damaging Het
Zfp593 A G 4: 134,244,913 V94A probably benign Het
Other mutations in Celf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Celf5 APN 10 81467080 unclassified probably benign
IGL02193:Celf5 APN 10 81470673 missense probably damaging 1.00
IGL02199:Celf5 APN 10 81482484 missense possibly damaging 0.71
R0012:Celf5 UTSW 10 81469512 missense probably damaging 0.99
R0207:Celf5 UTSW 10 81470698 missense probably null 1.00
R0242:Celf5 UTSW 10 81464409 missense probably benign 0.00
R0242:Celf5 UTSW 10 81464409 missense probably benign 0.00
R0607:Celf5 UTSW 10 81466005 missense probably damaging 1.00
R1165:Celf5 UTSW 10 81471338 missense probably damaging 1.00
R1775:Celf5 UTSW 10 81467304 unclassified probably benign
R1796:Celf5 UTSW 10 81467219 missense possibly damaging 0.90
R2291:Celf5 UTSW 10 81467047 missense probably damaging 0.98
R4812:Celf5 UTSW 10 81470739 missense probably damaging 1.00
R5367:Celf5 UTSW 10 81467264 missense probably damaging 1.00
R7033:Celf5 UTSW 10 81462714 missense probably damaging 0.99
R7226:Celf5 UTSW 10 81468029 missense probably damaging 0.98
Z1088:Celf5 UTSW 10 81466949 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCTCTGATCACAGCCTG -3'
(R):5'- TCTCTGGGCCTAGAAGATGTTG -3'

Sequencing Primer
(F):5'- CTGGGCTGCACATCCAG -3'
(R):5'- CCTAGAAGATGTTGGTGTATCCTATC -3'
Posted On2018-04-02