Incidental Mutation 'R6323:Dnajc14'
ID510212
Institutional Source Beutler Lab
Gene Symbol Dnajc14
Ensembl Gene ENSMUSG00000025354
Gene NameDnaJ heat shock protein family (Hsp40) member C14
SynonymsDRIP78, LIP6, HDJ3, 5730551F12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R6323 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location128804062-128819446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128807490 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 427 (E427G)
Ref Sequence ENSEMBL: ENSMUSP00000151343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026410] [ENSMUST00000051011] [ENSMUST00000139227] [ENSMUST00000217745] [ENSMUST00000218001] [ENSMUST00000218511] [ENSMUST00000219508]
Predicted Effect probably damaging
Transcript: ENSMUST00000026410
AA Change: E427G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026410
Gene: ENSMUSG00000025354
AA Change: E427G

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
low complexity region 164 176 N/A INTRINSIC
transmembrane domain 300 322 N/A INTRINSIC
transmembrane domain 327 349 N/A INTRINSIC
DnaJ 443 500 1.3e-21 SMART
Pfam:Jiv90 532 621 5.9e-40 PFAM
low complexity region 690 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051011
SMART Domains Protein: ENSMUSP00000050451
Gene: ENSMUSG00000047090

DomainStartEndE-ValueType
Pfam:DUF4203 43 240 2.4e-47 PFAM
low complexity region 257 271 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139227
SMART Domains Protein: ENSMUSP00000118082
Gene: ENSMUSG00000047090

DomainStartEndE-ValueType
Pfam:DUF4203 42 96 4.5e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152966
SMART Domains Protein: ENSMUSP00000117574
Gene: ENSMUSG00000047090

DomainStartEndE-ValueType
Pfam:DUF4203 42 241 1.9e-56 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217745
AA Change: E427G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000218001
Predicted Effect probably benign
Transcript: ENSMUST00000218511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219473
Predicted Effect probably damaging
Transcript: ENSMUST00000219508
AA Change: E427G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.248 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik G A 10: 82,283,082 T4698I probably benign Het
4933409G03Rik A G 2: 68,606,224 T171A unknown Het
Akr1c6 A G 13: 4,447,018 K153R possibly damaging Het
Ano1 T A 7: 144,611,686 I601F possibly damaging Het
Arfgef2 A G 2: 166,834,484 Y8C probably damaging Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
Baz2a A G 10: 128,126,417 I1816V probably benign Het
Cadps2 T A 6: 23,263,578 T1294S probably benign Het
Casz1 T C 4: 148,941,704 S952P possibly damaging Het
Cdc20 T C 4: 118,435,564 N329S probably damaging Het
Ceacam1 A C 7: 25,474,651 L193R probably damaging Het
Celf5 A G 10: 81,469,503 S143P probably damaging Het
Cfap74 A G 4: 155,463,938 D1342G possibly damaging Het
Chd5 C A 4: 152,367,334 T701K probably damaging Het
Cpt1b C A 15: 89,419,063 M596I probably benign Het
Ctrb1 A G 8: 111,689,591 V21A probably benign Het
Diaph3 C T 14: 86,966,453 V579I probably benign Het
Dlc1 T C 8: 36,938,383 E84G possibly damaging Het
Galns T C 8: 122,598,651 D254G probably damaging Het
Gpn3 C T 5: 122,372,575 probably benign Het
Gstm1 A G 3: 108,017,747 V10A probably benign Het
Krt13 C A 11: 100,121,150 A116S probably damaging Het
Lars2 A T 9: 123,441,594 K584* probably null Het
Lrrc43 G T 5: 123,503,886 G600W probably damaging Het
Madd G T 2: 91,161,438 probably null Het
Mnat1 A G 12: 73,168,104 D65G probably damaging Het
Nsmf A G 2: 25,055,051 N42S possibly damaging Het
Olfr1283 T C 2: 111,368,701 L23P possibly damaging Het
Olfr198 A G 16: 59,202,282 L48P probably damaging Het
Palld A T 8: 61,720,693 W311R probably damaging Het
Pax1 T A 2: 147,368,401 V352E probably damaging Het
Rnf2 T C 1: 151,473,216 K51R probably damaging Het
Rpl7l1 C A 17: 46,782,638 probably benign Het
Slc17a2 A G 13: 23,814,986 I121V probably benign Het
Slc1a6 G A 10: 78,812,887 G481S probably damaging Het
Trav6-1 T C 14: 52,638,791 V56A possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r79 T A 7: 87,001,314 C103S probably benign Het
Wwp2 A T 8: 107,540,671 H305L probably damaging Het
Zfp593 A G 4: 134,244,913 V94A probably benign Het
Other mutations in Dnajc14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Dnajc14 APN 10 128806332 missense probably damaging 1.00
IGL00924:Dnajc14 APN 10 128817319 missense probably benign
IGL00943:Dnajc14 APN 10 128816806 missense possibly damaging 0.92
IGL02833:Dnajc14 APN 10 128806599 missense possibly damaging 0.94
IGL02799:Dnajc14 UTSW 10 128806856 missense possibly damaging 0.88
PIT4812001:Dnajc14 UTSW 10 128806683 missense probably damaging 0.96
R0054:Dnajc14 UTSW 10 128807579 missense probably damaging 1.00
R0054:Dnajc14 UTSW 10 128807579 missense probably damaging 1.00
R1932:Dnajc14 UTSW 10 128816792 missense probably damaging 1.00
R4412:Dnajc14 UTSW 10 128806205 start gained probably benign
R4717:Dnajc14 UTSW 10 128806244 missense possibly damaging 0.92
R4804:Dnajc14 UTSW 10 128814057 missense probably benign 0.06
R4870:Dnajc14 UTSW 10 128817350 missense probably benign 0.00
R6325:Dnajc14 UTSW 10 128807490 missense probably damaging 1.00
R6399:Dnajc14 UTSW 10 128807490 missense probably damaging 1.00
R6400:Dnajc14 UTSW 10 128807490 missense probably damaging 1.00
R6452:Dnajc14 UTSW 10 128807490 missense probably damaging 1.00
R6453:Dnajc14 UTSW 10 128807490 missense probably damaging 1.00
R6556:Dnajc14 UTSW 10 128814631 missense probably benign 0.42
R6847:Dnajc14 UTSW 10 128816787 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- TCTCTTGGCTGGGTTCTCCA -3'
(R):5'- GGAAATCCTTCACCTTCCCTTG -3'

Sequencing Primer
(F):5'- GGGTTCTCCAGCCTTGC -3'
(R):5'- TTGACTCTACACTCCCTAAAAACTGG -3'
Posted On2018-04-02