Incidental Mutation 'R6323:Slc17a2'
ID510216
Institutional Source Beutler Lab
Gene Symbol Slc17a2
Ensembl Gene ENSMUSG00000036110
Gene Namesolute carrier family 17 (sodium phosphate), member 2
SynonymsNPT3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R6323 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location23806993-23825180 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23814986 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 121 (I121V)
Ref Sequence ENSEMBL: ENSMUSP00000097288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006786] [ENSMUST00000099697]
Predicted Effect probably benign
Transcript: ENSMUST00000006786
AA Change: I121V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000006786
Gene: ENSMUSG00000036110
AA Change: I121V

DomainStartEndE-ValueType
Pfam:MFS_1 19 425 3.5e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099697
AA Change: I121V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097288
Gene: ENSMUSG00000036110
AA Change: I121V

DomainStartEndE-ValueType
Pfam:MFS_1 19 425 2.9e-45 PFAM
transmembrane domain 443 462 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141717
Meta Mutation Damage Score 0.1 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik G A 10: 82,283,082 T4698I probably benign Het
4933409G03Rik A G 2: 68,606,224 T171A unknown Het
Akr1c6 A G 13: 4,447,018 K153R possibly damaging Het
Ano1 T A 7: 144,611,686 I601F possibly damaging Het
Arfgef2 A G 2: 166,834,484 Y8C probably damaging Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
Baz2a A G 10: 128,126,417 I1816V probably benign Het
Cadps2 T A 6: 23,263,578 T1294S probably benign Het
Casz1 T C 4: 148,941,704 S952P possibly damaging Het
Cdc20 T C 4: 118,435,564 N329S probably damaging Het
Ceacam1 A C 7: 25,474,651 L193R probably damaging Het
Celf5 A G 10: 81,469,503 S143P probably damaging Het
Cfap74 A G 4: 155,463,938 D1342G possibly damaging Het
Chd5 C A 4: 152,367,334 T701K probably damaging Het
Cpt1b C A 15: 89,419,063 M596I probably benign Het
Ctrb1 A G 8: 111,689,591 V21A probably benign Het
Diaph3 C T 14: 86,966,453 V579I probably benign Het
Dlc1 T C 8: 36,938,383 E84G possibly damaging Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Galns T C 8: 122,598,651 D254G probably damaging Het
Gpn3 C T 5: 122,372,575 probably benign Het
Gstm1 A G 3: 108,017,747 V10A probably benign Het
Krt13 C A 11: 100,121,150 A116S probably damaging Het
Lars2 A T 9: 123,441,594 K584* probably null Het
Lrrc43 G T 5: 123,503,886 G600W probably damaging Het
Madd G T 2: 91,161,438 probably null Het
Mnat1 A G 12: 73,168,104 D65G probably damaging Het
Nsmf A G 2: 25,055,051 N42S possibly damaging Het
Olfr1283 T C 2: 111,368,701 L23P possibly damaging Het
Olfr198 A G 16: 59,202,282 L48P probably damaging Het
Palld A T 8: 61,720,693 W311R probably damaging Het
Pax1 T A 2: 147,368,401 V352E probably damaging Het
Rnf2 T C 1: 151,473,216 K51R probably damaging Het
Rpl7l1 C A 17: 46,782,638 probably benign Het
Slc1a6 G A 10: 78,812,887 G481S probably damaging Het
Trav6-1 T C 14: 52,638,791 V56A possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r79 T A 7: 87,001,314 C103S probably benign Het
Wwp2 A T 8: 107,540,671 H305L probably damaging Het
Zfp593 A G 4: 134,244,913 V94A probably benign Het
Other mutations in Slc17a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Slc17a2 APN 13 23819334 missense probably benign 0.13
IGL01511:Slc17a2 APN 13 23819138 critical splice donor site probably null
IGL01624:Slc17a2 APN 13 23814986 missense probably benign 0.00
IGL01839:Slc17a2 APN 13 23812685 missense possibly damaging 0.91
IGL02010:Slc17a2 APN 13 23819042 missense probably benign 0.00
IGL03299:Slc17a2 APN 13 23821111 critical splice donor site probably null
R0622:Slc17a2 UTSW 13 23812611 missense probably damaging 1.00
R1104:Slc17a2 UTSW 13 23819937 missense probably damaging 0.99
R1530:Slc17a2 UTSW 13 23819069 missense probably damaging 1.00
R1682:Slc17a2 UTSW 13 23812640 missense probably damaging 0.96
R2255:Slc17a2 UTSW 13 23821008 missense probably benign 0.09
R4923:Slc17a2 UTSW 13 23819095 missense probably benign 0.20
R5193:Slc17a2 UTSW 13 23819862 critical splice acceptor site probably null
R5321:Slc17a2 UTSW 13 23812631 missense possibly damaging 0.95
R5334:Slc17a2 UTSW 13 23819051 missense probably damaging 0.97
R5377:Slc17a2 UTSW 13 23812592 missense probably damaging 1.00
R6165:Slc17a2 UTSW 13 23815070 missense probably benign 0.00
R6280:Slc17a2 UTSW 13 23822394 missense probably benign
R6311:Slc17a2 UTSW 13 23815022 missense probably benign 0.40
R6476:Slc17a2 UTSW 13 23812586 missense probably damaging 1.00
R6814:Slc17a2 UTSW 13 23822389 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TTTTAGCAAAGAGGGTGCCC -3'
(R):5'- TGTGAACTGACCAGTCCAGG -3'

Sequencing Primer
(F):5'- GGGTGCCCCTACTAACTAAGAAC -3'
(R):5'- GGCCATTCCCTGCAATGAAAGTG -3'
Posted On2018-04-02