Incidental Mutation 'R6325:Itsn2'
ID510242
Institutional Source Beutler Lab
Gene Symbol Itsn2
Ensembl Gene ENSMUSG00000020640
Gene Nameintersectin 2
SynonymsSh3d1B, Eh domain, SH3 domain regulator of endocytosis 2, Ese2, Sh3p18
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6325 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location4592638-4713962 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4706351 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1349 (I1349N)
Ref Sequence ENSEMBL: ENSMUSP00000151896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062580] [ENSMUST00000219007] [ENSMUST00000220311]
Predicted Effect probably damaging
Transcript: ENSMUST00000062580
AA Change: I1322N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052758
Gene: ENSMUSG00000020640
AA Change: I1322N

DomainStartEndE-ValueType
EH 15 109 8.44e-41 SMART
EFh 58 86 7.18e-3 SMART
low complexity region 156 169 N/A INTRINSIC
low complexity region 215 231 N/A INTRINSIC
EH 238 333 4.06e-43 SMART
EFh 282 310 6.16e-2 SMART
coiled coil region 366 462 N/A INTRINSIC
coiled coil region 516 556 N/A INTRINSIC
coiled coil region 580 715 N/A INTRINSIC
SH3 721 778 2.65e-21 SMART
low complexity region 791 811 N/A INTRINSIC
SH3 855 909 8.83e-18 SMART
SH3 945 999 9.1e-20 SMART
SH3 1017 1077 1.55e-13 SMART
SH3 1091 1146 7.22e-23 SMART
RhoGEF 1174 1355 1.93e-56 SMART
PH 1396 1507 1.16e-9 SMART
C2 1531 1628 3.96e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218923
Predicted Effect probably damaging
Transcript: ENSMUST00000219007
AA Change: I1322N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219182
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219832
Predicted Effect probably damaging
Transcript: ENSMUST00000220311
AA Change: I1349N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.322 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein which contains SH3 domains. This protein is a member of a family of proteins involved in clathrin-mediated endocytosis. Intersectin 2 is thought to regulate the formation of clathrin-coated vesicles and also may function in the induction of T cell antigen receptor (TCR) endocytosis. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal brain morphology and function and behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl T C 2: 128,123,024 I596T probably benign Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Birc7 G A 2: 180,929,450 D102N probably benign Het
Cct8 A C 16: 87,495,727 probably null Het
Cntn5 T C 9: 10,144,323 probably null Het
Cyp11a1 A G 9: 58,025,568 N396D probably benign Het
Dip2b T C 15: 100,154,282 S255P probably benign Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Fancm T A 12: 65,125,052 M1822K probably damaging Het
Far2 T C 6: 148,157,497 V227A probably benign Het
Fbrsl1 A G 5: 110,377,407 F100L probably damaging Het
Gm5771 T C 6: 41,396,656 V151A probably benign Het
Gpd2 T C 2: 57,304,396 S104P probably damaging Het
Grp T C 18: 65,873,753 probably null Het
Hamp A C 7: 30,943,903 H27Q probably benign Het
Hecw1 T A 13: 14,316,446 S241C probably damaging Het
Nr4a2 A G 2: 57,112,418 Y8H probably damaging Het
Olfr263 A T 13: 21,133,075 Q100L probably damaging Het
Olfr320 T A 11: 58,684,528 Y218* probably null Het
Pla2g2e T C 4: 138,880,425 Y39H probably damaging Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Ptpn20 A T 14: 33,631,005 T234S possibly damaging Het
Smarca2 T A 19: 26,678,363 V810E probably damaging Het
Taar2 A T 10: 23,940,717 M52L probably benign Het
Tex47 A T 5: 7,304,935 R39* probably null Het
Tnxb T A 17: 34,692,424 V1567D probably damaging Het
Ttll6 T C 11: 96,135,505 Y79H probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfp462 C T 4: 55,080,680 T1344I probably benign Het
Zfp804a A T 2: 82,257,038 I404L possibly damaging Het
Other mutations in Itsn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Itsn2 APN 12 4658027 missense possibly damaging 0.95
IGL00647:Itsn2 APN 12 4613311 splice site probably benign
IGL00933:Itsn2 APN 12 4707540 missense probably damaging 1.00
IGL01686:Itsn2 APN 12 4636693 splice site probably benign
IGL01873:Itsn2 APN 12 4632366 splice site probably benign
IGL02200:Itsn2 APN 12 4636632 missense probably damaging 0.98
IGL02280:Itsn2 APN 12 4708961 missense possibly damaging 0.89
IGL02388:Itsn2 APN 12 4629557 missense possibly damaging 0.91
IGL02938:Itsn2 APN 12 4697216 missense probably damaging 0.98
inversus UTSW 12 4639670 nonsense probably null
liberator UTSW 12 4666176 nonsense probably null
rolled UTSW 12 4634792 nonsense probably null
stratofortress UTSW 12 4624927 missense probably damaging 1.00
R0101:Itsn2 UTSW 12 4633058 unclassified probably benign
R0268:Itsn2 UTSW 12 4700333 missense probably benign 0.12
R0584:Itsn2 UTSW 12 4697180 missense probably benign
R0604:Itsn2 UTSW 12 4658189 missense probably benign 0.01
R0639:Itsn2 UTSW 12 4712556 missense probably damaging 0.99
R0738:Itsn2 UTSW 12 4635681 missense probably benign 0.17
R1132:Itsn2 UTSW 12 4658464 missense probably damaging 1.00
R1163:Itsn2 UTSW 12 4712009 missense probably benign 0.30
R1169:Itsn2 UTSW 12 4639694 missense probably damaging 1.00
R1258:Itsn2 UTSW 12 4673464 missense probably damaging 1.00
R1297:Itsn2 UTSW 12 4700378 missense probably damaging 1.00
R1423:Itsn2 UTSW 12 4673572 missense probably damaging 0.97
R1572:Itsn2 UTSW 12 4650044 missense probably benign 0.03
R1601:Itsn2 UTSW 12 4658452 missense probably benign 0.01
R1628:Itsn2 UTSW 12 4629652 missense probably benign
R1650:Itsn2 UTSW 12 4637767 missense probably damaging 0.97
R1752:Itsn2 UTSW 12 4711950 splice site probably null
R1758:Itsn2 UTSW 12 4658160 missense possibly damaging 0.83
R1942:Itsn2 UTSW 12 4639670 nonsense probably null
R1976:Itsn2 UTSW 12 4672733 splice site probably benign
R2000:Itsn2 UTSW 12 4666176 nonsense probably null
R2060:Itsn2 UTSW 12 4627879 missense probably damaging 1.00
R2119:Itsn2 UTSW 12 4707025 missense probably benign 0.32
R2168:Itsn2 UTSW 12 4633044 unclassified probably benign
R2394:Itsn2 UTSW 12 4707005 missense possibly damaging 0.86
R2860:Itsn2 UTSW 12 4700315 splice site probably benign
R2861:Itsn2 UTSW 12 4700315 splice site probably benign
R2900:Itsn2 UTSW 12 4630713 unclassified probably benign
R2991:Itsn2 UTSW 12 4658474 missense probably benign 0.01
R3087:Itsn2 UTSW 12 4666303 missense probably damaging 1.00
R3881:Itsn2 UTSW 12 4634546 unclassified probably benign
R4022:Itsn2 UTSW 12 4624927 missense probably damaging 1.00
R4332:Itsn2 UTSW 12 4712611 missense possibly damaging 0.72
R4657:Itsn2 UTSW 12 4713197 makesense probably null
R4727:Itsn2 UTSW 12 4707660 missense probably damaging 0.99
R4745:Itsn2 UTSW 12 4661944 missense probably damaging 1.00
R4770:Itsn2 UTSW 12 4627892 missense probably damaging 1.00
R4905:Itsn2 UTSW 12 4634583 unclassified probably benign
R5269:Itsn2 UTSW 12 4633553 unclassified probably benign
R5314:Itsn2 UTSW 12 4627960 missense probably benign 0.09
R5345:Itsn2 UTSW 12 4672783 missense probably damaging 1.00
R5399:Itsn2 UTSW 12 4653535 missense probably benign 0.22
R5566:Itsn2 UTSW 12 4626554 missense probably damaging 1.00
R5725:Itsn2 UTSW 12 4630767 unclassified probably benign
R5773:Itsn2 UTSW 12 4707089 missense probably damaging 1.00
R6116:Itsn2 UTSW 12 4629939 unclassified probably benign
R6254:Itsn2 UTSW 12 4624982 splice site probably null
R6361:Itsn2 UTSW 12 4629655 missense probably benign 0.18
R6456:Itsn2 UTSW 12 4629923 unclassified probably benign
R6494:Itsn2 UTSW 12 4634792 nonsense probably null
R6854:Itsn2 UTSW 12 4652382 missense probably benign 0.37
R6941:Itsn2 UTSW 12 4629641 missense probably benign 0.05
R6961:Itsn2 UTSW 12 4673420 nonsense probably null
R7326:Itsn2 UTSW 12 4632985 missense unknown
R7387:Itsn2 UTSW 12 4639781 missense probably damaging 1.00
R7465:Itsn2 UTSW 12 4706983 nonsense probably null
R7471:Itsn2 UTSW 12 4708198 missense probably benign 0.43
Z1088:Itsn2 UTSW 12 4712472 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTAACCTGACATGTGCC -3'
(R):5'- CACAGTTTGAAGAGGGCCTTAC -3'

Sequencing Primer
(F):5'- AACCTGACATGTGCCATTTCAG -3'
(R):5'- TTACCCCTCCTATACCACAGG -3'
Posted On2018-04-02