Incidental Mutation 'R6318:1700102P08Rik'
ID510291
Institutional Source Beutler Lab
Gene Symbol 1700102P08Rik
Ensembl Gene ENSMUSG00000032611
Gene NameRIKEN cDNA 1700102P08 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R6318 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location108392805-108410934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108393275 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 13 (T13A)
Ref Sequence ENSEMBL: ENSMUSP00000141566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035234] [ENSMUST00000035237] [ENSMUST00000192995] [ENSMUST00000194959]
Predicted Effect probably benign
Transcript: ENSMUST00000035234
AA Change: T13A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000035237
SMART Domains Protein: ENSMUSP00000035237
Gene: ENSMUSG00000032612

DomainStartEndE-ValueType
DUSP 27 125 1.39e-46 SMART
Pfam:Ubiquitin_3 139 226 6.7e-34 PFAM
low complexity region 263 286 N/A INTRINSIC
Pfam:UCH 301 919 2.2e-84 PFAM
Pfam:UCH_1 302 507 2.8e-8 PFAM
Pfam:UCH_1 605 901 1.4e-15 PFAM
low complexity region 927 938 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000192995
AA Change: T13A

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000193288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194939
Predicted Effect probably benign
Transcript: ENSMUST00000194959
SMART Domains Protein: ENSMUSP00000141368
Gene: ENSMUSG00000032612

DomainStartEndE-ValueType
DUSP 27 125 5.5e-49 SMART
Pfam:Ubiquitin_3 139 226 1.7e-30 PFAM
Pfam:UCH 254 872 7e-89 PFAM
Pfam:UCH_1 255 469 3.5e-8 PFAM
Pfam:UCH_1 566 854 2.5e-14 PFAM
low complexity region 880 891 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195351
Predicted Effect probably benign
Transcript: ENSMUST00000195608
Meta Mutation Damage Score 0.25 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.3%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T C 9: 44,275,348 T500A probably benign Het
Adcy4 T A 14: 55,769,224 I1051F probably damaging Het
Adgrg6 A T 10: 14,467,497 N235K probably benign Het
Aldh3a2 A C 11: 61,262,419 Y160* probably null Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Armt1 T C 10: 4,450,859 M202T probably benign Het
AU019823 T C 9: 50,607,461 R284G probably benign Het
Brd2 C A 17: 34,112,898 V349F probably damaging Het
Btnl10 A T 11: 58,926,865 probably benign Het
Ccdc178 A G 18: 22,120,534 V216A possibly damaging Het
Ccdc85c A T 12: 108,274,709 L142Q unknown Het
Cdc27 A T 11: 104,528,694 S172T probably damaging Het
Ceacam14 T C 7: 17,814,312 I109T probably damaging Het
Ces5a C T 8: 93,534,583 G72E probably damaging Het
Cfb A G 17: 34,861,824 Y66H possibly damaging Het
Clec14a G A 12: 58,268,215 P207L probably damaging Het
Clec16a G A 16: 10,630,788 R599H probably damaging Het
Csmd1 A T 8: 15,903,212 I3423N probably damaging Het
Cyp4a29 C A 4: 115,250,199 N243K probably benign Het
Ddx59 T C 1: 136,416,872 F94L probably damaging Het
Dusp3 A C 11: 101,986,871 V19G probably benign Het
Fat3 T C 9: 15,916,984 probably benign Het
Fgfr4 T A 13: 55,166,108 V545E probably damaging Het
Fxn G T 19: 24,280,426 A47D probably damaging Het
Gdpgp1 A T 7: 80,239,150 I310F possibly damaging Het
Gm7210 A T 7: 11,594,113 noncoding transcript Het
Grm7 G T 6: 111,358,875 C749F probably damaging Het
Hps4 T G 5: 112,346,629 V26G probably damaging Het
Igf1r A G 7: 68,165,233 D294G probably benign Het
Immp1l T C 2: 105,930,827 F27S probably benign Het
Kcnk3 T A 5: 30,622,586 C327S probably damaging Het
Kif13a T A 13: 46,815,207 probably null Het
Krtap5-4 T C 7: 142,304,090 S166P unknown Het
Lyst G A 13: 13,743,311 D3319N possibly damaging Het
Malrd1 T G 2: 16,042,267 S1735A unknown Het
Myh4 A G 11: 67,243,442 T308A probably benign Het
Myh8 A T 11: 67,299,341 Q1269L probably benign Het
Myo15b G A 11: 115,890,831 V1367I probably damaging Het
Nae1 T C 8: 104,523,637 D208G probably benign Het
Nelfe T A 17: 34,854,456 V296D probably damaging Het
Npepps A T 11: 97,218,548 V734E probably damaging Het
Ogdh A G 11: 6,349,390 N752S probably damaging Het
Olfr1094 A G 2: 86,829,654 I301V possibly damaging Het
Olfr266 T C 3: 106,822,187 D124G probably damaging Het
Olfr401 A T 11: 74,121,721 Q144L possibly damaging Het
Olfr906 T C 9: 38,488,377 M116T probably benign Het
Otof C A 5: 30,414,544 G171V probably damaging Het
Phtf2 A T 5: 20,801,941 V208D probably damaging Het
Pkn1 T A 8: 83,683,591 T340S probably damaging Het
Plcd4 C T 1: 74,563,594 L668F possibly damaging Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Prss50 A T 9: 110,861,299 D170V probably damaging Het
Ptprg T C 14: 12,237,118 V604A probably damaging Het
Rab33b T C 3: 51,493,405 V100A probably damaging Het
Rbm26 T A 14: 105,131,535 D736V probably damaging Het
Rela C A 19: 5,646,964 P400T probably benign Het
Rpusd4 T C 9: 35,268,038 L50P probably damaging Het
Scn10a A C 9: 119,627,115 Y1214D probably damaging Het
Sema3c A G 5: 17,672,432 E179G probably damaging Het
Skint5 T A 4: 113,517,133 D1253V unknown Het
Sp4 G T 12: 118,238,178 P771H probably damaging Het
Sphkap T A 1: 83,278,378 Y263F probably damaging Het
Ssbp1 G A 6: 40,476,753 V78I probably benign Het
St3gal6 A G 16: 58,486,406 I87T probably benign Het
Tango6 T A 8: 106,818,497 D997E probably benign Het
Tpr C T 1: 150,445,888 P2265S possibly damaging Het
Ttc7b A T 12: 100,325,677 F212Y probably damaging Het
Ubc A G 5: 125,388,260 M1T probably null Het
Vill G C 9: 119,063,648 Q376H probably benign Het
Yes1 T C 5: 32,651,686 I132T possibly damaging Het
Ythdc2 A G 18: 44,860,377 T830A probably benign Het
Zbtb41 T A 1: 139,430,306 F451I possibly damaging Het
Zfp995 C T 17: 21,880,512 C247Y probably benign Het
Other mutations in 1700102P08Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:1700102P08Rik APN 9 108397406 missense probably damaging 1.00
R1199:1700102P08Rik UTSW 9 108393477 missense possibly damaging 0.71
R1885:1700102P08Rik UTSW 9 108393610 missense possibly damaging 0.84
R1886:1700102P08Rik UTSW 9 108393610 missense possibly damaging 0.84
R1887:1700102P08Rik UTSW 9 108393610 missense possibly damaging 0.84
R4455:1700102P08Rik UTSW 9 108397196 missense possibly damaging 0.65
R4926:1700102P08Rik UTSW 9 108395299 missense probably damaging 0.98
R5282:1700102P08Rik UTSW 9 108393240 start codon destroyed probably null 1.00
R5645:1700102P08Rik UTSW 9 108397204 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGAGAATGGCGGGTGATC -3'
(R):5'- GTTCTCACTCTCAGGAGCAC -3'

Sequencing Primer
(F):5'- AACGAAGGATGATGTTGTATAACC -3'
(R):5'- ACTCTCAGGAGCACACGAGG -3'
Posted On2018-04-02