Incidental Mutation 'R6318:Cfb'
ID510320
Institutional Source Beutler Lab
Gene Symbol Cfb
Ensembl Gene ENSMUSG00000090231
Gene Namecomplement factor B
SynonymsFB, Factor B, B, alternative-complement pathway C3/C5 convertase, Bf, H2-Bf
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6318 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location34856374-34862518 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34861824 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 66 (Y66H)
Ref Sequence ENSEMBL: ENSMUSP00000120990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025229] [ENSMUST00000025230] [ENSMUST00000128767] [ENSMUST00000146299] [ENSMUST00000148431] [ENSMUST00000152417] [ENSMUST00000153400] [ENSMUST00000154526] [ENSMUST00000176203]
Predicted Effect probably benign
Transcript: ENSMUST00000025229
AA Change: Y68H

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000025229
Gene: ENSMUSG00000090231
AA Change: Y68H

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
CCP 36 88 5.15e-1 SMART
CCP 102 157 4.62e-15 SMART
CCP 164 217 2.06e-12 SMART
VWA 267 472 1.07e-40 SMART
Tryp_SPc 480 751 2.53e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000025230
SMART Domains Protein: ENSMUSP00000025230
Gene: ENSMUSG00000024371

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Blast:CCP 22 71 8e-24 BLAST
low complexity region 72 83 N/A INTRINSIC
CCP 94 149 1.34e-11 SMART
CCP 156 210 1.89e-11 SMART
Blast:VWA 219 245 1e-7 BLAST
VWA 259 464 1.32e-31 SMART
Tryp_SPc 468 747 4.43e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127795
Predicted Effect probably benign
Transcript: ENSMUST00000128767
AA Change: Y66H

PolyPhen 2 Score 0.203 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000119977
Gene: ENSMUSG00000090231
AA Change: Y66H

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
CCP 34 86 5.15e-1 SMART
CCP 100 155 4.62e-15 SMART
CCP 162 215 2.06e-12 SMART
VWA 265 470 1.07e-40 SMART
Tryp_SPc 478 749 2.53e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129891
SMART Domains Protein: ENSMUSP00000120864
Gene: ENSMUSG00000092511

DomainStartEndE-ValueType
Blast:VWA 2 77 8e-7 BLAST
Tryp_SPc 85 365 5.69e-8 SMART
CCP 310 365 4.62e-15 SMART
CCP 372 425 2.06e-12 SMART
VWA 475 680 1.07e-40 SMART
Tryp_SPc 688 959 2.53e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133127
SMART Domains Protein: ENSMUSP00000118360
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
PDB:2WIN|L 2 43 2e-20 PDB
Blast:VWA 13 44 9e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000134300
SMART Domains Protein: ENSMUSP00000114241
Gene: ENSMUSG00000024371

DomainStartEndE-ValueType
Tryp_SPc 3 148 6.48e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141295
SMART Domains Protein: ENSMUSP00000118945
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
Tryp_SPc 18 258 3.76e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000146299
AA Change: Y581H
SMART Domains Protein: ENSMUSP00000117677
Gene: ENSMUSG00000092511
AA Change: Y581H

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
CCP 94 148 1.89e-11 SMART
VWA 103 311 1.74e-1 SMART
Tryp_SPc 315 547 1.49e-7 SMART
CCP 549 601 5.15e-1 SMART
CCP 615 670 4.62e-15 SMART
CCP 677 730 2.06e-12 SMART
VWA 780 985 1.07e-40 SMART
Tryp_SPc 993 1264 2.53e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148431
SMART Domains Protein: ENSMUSP00000120009
Gene: ENSMUSG00000024371

DomainStartEndE-ValueType
VWA 33 187 2.33e0 SMART
Tryp_SPc 191 470 4.43e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152417
SMART Domains Protein: ENSMUSP00000123536
Gene: ENSMUSG00000024371

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
CCP 19 73 1.89e-11 SMART
Blast:VWA 82 108 2e-7 BLAST
VWA 122 327 1.32e-31 SMART
Tryp_SPc 331 610 4.43e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153400
SMART Domains Protein: ENSMUSP00000116497
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
Tryp_SPc 1 217 2.36e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000154526
AA Change: Y66H

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120990
Gene: ENSMUSG00000090231
AA Change: Y66H

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
CCP 34 86 5.15e-1 SMART
CCP 100 155 4.62e-15 SMART
CCP 162 215 2.06e-12 SMART
VWA 265 470 1.07e-40 SMART
Tryp_SPc 478 711 5.03e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000176203
AA Change: Y68H

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000135660
Gene: ENSMUSG00000090231
AA Change: Y68H

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
CCP 36 88 5.15e-1 SMART
CCP 102 157 4.62e-15 SMART
CCP 164 217 2.06e-12 SMART
VWA 267 472 1.07e-40 SMART
Tryp_SPc 480 713 5.03e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184774
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.3%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes complement factor B, a component of the alternative pathway of complement activation. Factor B circulates in the blood as a single chain polypeptide. Upon activation of the alternative pathway, it is cleaved by complement factor D yielding the noncatalytic chain Ba and the catalytic subunit Bb. The active subunit Bb is a serine protease which associates with C3b to form the alternative pathway C3 convertase. Bb is involved in the proliferation of preactivated B lymphocytes, while Ba inhibits their proliferation. This gene localizes to the major histocompatibility complex (MHC) class III region on chromosome 6. This cluster includes several genes involved in regulation of the immune reaction. Polymorphisms in this gene are associated with a reduced risk of age-related macular degeneration. The polyadenylation site of this gene is 421 bp from the 5' end of the gene for complement component 2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations lack the alternative complement pathway, and have reduced overall complement activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A G 9: 108,393,275 T13A possibly damaging Het
Abcg4 T C 9: 44,275,348 T500A probably benign Het
Adcy4 T A 14: 55,769,224 I1051F probably damaging Het
Adgrg6 A T 10: 14,467,497 N235K probably benign Het
Aldh3a2 A C 11: 61,262,419 Y160* probably null Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Armt1 T C 10: 4,450,859 M202T probably benign Het
AU019823 T C 9: 50,607,461 R284G probably benign Het
Brd2 C A 17: 34,112,898 V349F probably damaging Het
Btnl10 A T 11: 58,926,865 probably benign Het
Ccdc178 A G 18: 22,120,534 V216A possibly damaging Het
Ccdc85c A T 12: 108,274,709 L142Q unknown Het
Cdc27 A T 11: 104,528,694 S172T probably damaging Het
Ceacam14 T C 7: 17,814,312 I109T probably damaging Het
Ces5a C T 8: 93,534,583 G72E probably damaging Het
Clec14a G A 12: 58,268,215 P207L probably damaging Het
Clec16a G A 16: 10,630,788 R599H probably damaging Het
Csmd1 A T 8: 15,903,212 I3423N probably damaging Het
Cyp4a29 C A 4: 115,250,199 N243K probably benign Het
Ddx59 T C 1: 136,416,872 F94L probably damaging Het
Dusp3 A C 11: 101,986,871 V19G probably benign Het
Fat3 T C 9: 15,916,984 probably benign Het
Fgfr4 T A 13: 55,166,108 V545E probably damaging Het
Fxn G T 19: 24,280,426 A47D probably damaging Het
Gdpgp1 A T 7: 80,239,150 I310F possibly damaging Het
Gm7210 A T 7: 11,594,113 noncoding transcript Het
Grm7 G T 6: 111,358,875 C749F probably damaging Het
Hps4 T G 5: 112,346,629 V26G probably damaging Het
Igf1r A G 7: 68,165,233 D294G probably benign Het
Immp1l T C 2: 105,930,827 F27S probably benign Het
Kcnk3 T A 5: 30,622,586 C327S probably damaging Het
Kif13a T A 13: 46,815,207 probably null Het
Krtap5-4 T C 7: 142,304,090 S166P unknown Het
Lyst G A 13: 13,743,311 D3319N possibly damaging Het
Malrd1 T G 2: 16,042,267 S1735A unknown Het
Myh4 A G 11: 67,243,442 T308A probably benign Het
Myh8 A T 11: 67,299,341 Q1269L probably benign Het
Myo15b G A 11: 115,890,831 V1367I probably damaging Het
Nae1 T C 8: 104,523,637 D208G probably benign Het
Nelfe T A 17: 34,854,456 V296D probably damaging Het
Npepps A T 11: 97,218,548 V734E probably damaging Het
Ogdh A G 11: 6,349,390 N752S probably damaging Het
Olfr1094 A G 2: 86,829,654 I301V possibly damaging Het
Olfr266 T C 3: 106,822,187 D124G probably damaging Het
Olfr401 A T 11: 74,121,721 Q144L possibly damaging Het
Olfr906 T C 9: 38,488,377 M116T probably benign Het
Otof C A 5: 30,414,544 G171V probably damaging Het
Phtf2 A T 5: 20,801,941 V208D probably damaging Het
Pkn1 T A 8: 83,683,591 T340S probably damaging Het
Plcd4 C T 1: 74,563,594 L668F possibly damaging Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Prss50 A T 9: 110,861,299 D170V probably damaging Het
Ptprg T C 14: 12,237,118 V604A probably damaging Het
Rab33b T C 3: 51,493,405 V100A probably damaging Het
Rbm26 T A 14: 105,131,535 D736V probably damaging Het
Rela C A 19: 5,646,964 P400T probably benign Het
Rpusd4 T C 9: 35,268,038 L50P probably damaging Het
Scn10a A C 9: 119,627,115 Y1214D probably damaging Het
Sema3c A G 5: 17,672,432 E179G probably damaging Het
Skint5 T A 4: 113,517,133 D1253V unknown Het
Sp4 G T 12: 118,238,178 P771H probably damaging Het
Sphkap T A 1: 83,278,378 Y263F probably damaging Het
Ssbp1 G A 6: 40,476,753 V78I probably benign Het
St3gal6 A G 16: 58,486,406 I87T probably benign Het
Tango6 T A 8: 106,818,497 D997E probably benign Het
Tpr C T 1: 150,445,888 P2265S possibly damaging Het
Ttc7b A T 12: 100,325,677 F212Y probably damaging Het
Ubc A G 5: 125,388,260 M1T probably null Het
Vill G C 9: 119,063,648 Q376H probably benign Het
Yes1 T C 5: 32,651,686 I132T possibly damaging Het
Ythdc2 A G 18: 44,860,377 T830A probably benign Het
Zbtb41 T A 1: 139,430,306 F451I possibly damaging Het
Zfp995 C T 17: 21,880,512 C247Y probably benign Het
Other mutations in Cfb
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0270:Cfb UTSW 17 34860386 missense possibly damaging 0.92
R0419:Cfb UTSW 17 34858509 missense probably damaging 1.00
R0514:Cfb UTSW 17 34860898 missense probably damaging 1.00
R0645:Cfb UTSW 17 34860016 missense probably benign 0.25
R0668:Cfb UTSW 17 34857103 missense probably benign 0.29
R0893:Cfb UTSW 17 34858055 missense probably damaging 1.00
R1879:Cfb UTSW 17 34860560 missense probably benign 0.11
R2135:Cfb UTSW 17 34857278 missense possibly damaging 0.84
R3107:Cfb UTSW 17 34861824 missense possibly damaging 0.88
R4291:Cfb UTSW 17 34861138 missense possibly damaging 0.95
R4369:Cfb UTSW 17 34860314 missense probably damaging 1.00
R4371:Cfb UTSW 17 34860314 missense probably damaging 1.00
R4616:Cfb UTSW 17 34859068 missense probably benign 0.29
R5177:Cfb UTSW 17 34859026 missense probably damaging 1.00
R5689:Cfb UTSW 17 34861794 missense probably benign 0.00
R5773:Cfb UTSW 17 34857272 nonsense probably null
R6046:Cfb UTSW 17 34862102 unclassified probably null
R6274:Cfb UTSW 17 34862093 missense probably benign 0.18
R7035:Cfb UTSW 17 34860031 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GACTGCCAGTCTCATAGCTC -3'
(R):5'- CCTCTGGAGGTAAGCAAAGG -3'

Sequencing Primer
(F):5'- ATAGCTCTCATCTTACCCAGCACTG -3'
(R):5'- CCTCTGGAGGTAAGCAAAGGATATTC -3'
Posted On2018-04-02