Incidental Mutation 'R6321:5430419D17Rik'
List |< first << previous [record 96 of 9592] next >> last >|
ID510346
Institutional Source Beutler Lab
Gene Symbol 5430419D17Rik
Ensembl Gene ENSMUSG00000006204
Gene NameRIKEN cDNA 5430419D17 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.044) question?
Stock #R6321 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location131174402-131306451 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 131257006 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124096] [ENSMUST00000208921]
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000208921
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actbl2 G T 13: 111,255,381 M83I probably damaging Het
Adgra2 T A 8: 27,114,162 M460K probably benign Het
Aldh16a1 G A 7: 45,149,765 A31V probably damaging Het
Ank2 T C 3: 126,946,938 probably benign Het
Arrdc4 C A 7: 68,749,045 D8Y probably benign Het
Auts2 A G 5: 131,466,115 Y110H probably damaging Het
Blnk A T 19: 40,934,459 Y405N probably damaging Het
Capsl T C 15: 9,461,769 F84L probably damaging Het
Cenpl T C 1: 161,074,895 S46P probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Chrnd C T 1: 87,192,229 R90C probably damaging Het
Cyfip2 A T 11: 46,291,520 M37K probably benign Het
Dnah11 T C 12: 118,142,292 E625G possibly damaging Het
Dnah5 T G 15: 28,372,411 V2936G probably damaging Het
Dock9 A G 14: 121,546,021 M2055T probably damaging Het
Epb41l2 A T 10: 25,468,128 R274S probably damaging Het
Erich3 A T 3: 154,727,502 H371L probably damaging Het
Evi5l C A 8: 4,203,080 P454T probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Golgb1 T A 16: 36,918,197 C2299* probably null Het
Heca G C 10: 17,915,243 probably null Het
Hecw1 C T 13: 14,522,829 A9T probably benign Het
Hs3st6 T A 17: 24,758,568 W341R probably damaging Het
Kidins220 C T 12: 25,057,534 S1571L probably benign Het
Klk9 A G 7: 43,794,308 E82G probably damaging Het
Ltbp3 C A 19: 5,745,657 H180Q probably benign Het
Mecom A G 3: 29,980,592 Y502H probably damaging Het
Mfsd2a A G 4: 122,949,372 V372A probably benign Het
Mrgprd A G 7: 145,322,142 D250G probably benign Het
Muc2 A G 7: 141,700,828 D191G probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Olfr1312 A G 2: 112,042,768 V88A probably benign Het
Olfr692 A G 7: 105,368,902 Y192C probably damaging Het
Pnpla6 T C 8: 3,544,015 V1342A probably benign Het
Ppp1r9a A G 6: 5,115,151 E789G probably damaging Het
Prkdc A G 16: 15,714,919 T1471A probably benign Het
Scarb1 T A 5: 125,304,331 S50C probably damaging Het
Slc4a8 C T 15: 100,789,164 T283M probably damaging Het
Smc2 C A 4: 52,462,814 D601E probably benign Het
Snx6 C A 12: 54,752,013 V221F probably damaging Het
Spag17 A C 3: 100,088,427 K1794T probably benign Het
Tpo A G 12: 30,103,108 W416R probably damaging Het
Ttc13 C A 8: 124,683,191 K427N probably damaging Het
Upf3a A T 8: 13,787,466 N137I possibly damaging Het
Ush2a C T 1: 188,849,046 Q3708* probably null Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zfp451 A G 1: 33,813,735 F33L probably damaging Het
Zfp454 A G 11: 50,873,049 F408L probably damaging Het
Zfp639 T C 3: 32,517,088 Y40H probably damaging Het
Other mutations in 5430419D17Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:5430419D17Rik APN 7 131238094 unclassified probably null
IGL00848:5430419D17Rik APN 7 131246724 missense probably damaging 1.00
IGL00966:5430419D17Rik APN 7 131243107 nonsense probably null
IGL01286:5430419D17Rik APN 7 131246703 missense probably damaging 1.00
IGL01303:5430419D17Rik APN 7 131194331 missense possibly damaging 0.53
IGL01585:5430419D17Rik APN 7 131244758 missense probably damaging 0.97
IGL01665:5430419D17Rik APN 7 131246657 nonsense probably null
IGL01953:5430419D17Rik APN 7 131224980 missense probably benign 0.04
IGL02427:5430419D17Rik APN 7 131244788 missense probably damaging 0.99
IGL02508:5430419D17Rik APN 7 131222830 missense probably damaging 1.00
IGL02678:5430419D17Rik APN 7 131228917 missense probably damaging 1.00
IGL03092:5430419D17Rik APN 7 131201798 critical splice donor site probably null
IGL03122:5430419D17Rik APN 7 131196514 missense possibly damaging 0.68
IGL03343:5430419D17Rik APN 7 131246691 missense probably damaging 1.00
R0011:5430419D17Rik UTSW 7 131229993 missense probably damaging 0.99
R0011:5430419D17Rik UTSW 7 131229993 missense probably damaging 0.99
R0234:5430419D17Rik UTSW 7 131194303 splice site probably null
R0234:5430419D17Rik UTSW 7 131194303 splice site probably null
R0268:5430419D17Rik UTSW 7 131238176 missense probably damaging 1.00
R0383:5430419D17Rik UTSW 7 131239539 missense probably benign 0.05
R0973:5430419D17Rik UTSW 7 131238182 missense probably damaging 1.00
R0973:5430419D17Rik UTSW 7 131238182 missense probably damaging 1.00
R0974:5430419D17Rik UTSW 7 131238182 missense probably damaging 1.00
R1572:5430419D17Rik UTSW 7 131244831 nonsense probably null
R1911:5430419D17Rik UTSW 7 131238089 missense probably damaging 1.00
R2032:5430419D17Rik UTSW 7 131243052 missense probably damaging 1.00
R2097:5430419D17Rik UTSW 7 131181964 nonsense probably null
R2221:5430419D17Rik UTSW 7 131247457 critical splice acceptor site probably null
R2223:5430419D17Rik UTSW 7 131247457 critical splice acceptor site probably null
R2254:5430419D17Rik UTSW 7 131222905 missense probably damaging 1.00
R2913:5430419D17Rik UTSW 7 131182024 missense possibly damaging 0.90
R2991:5430419D17Rik UTSW 7 131246700 missense probably damaging 1.00
R3439:5430419D17Rik UTSW 7 131188779 critical splice donor site probably null
R4418:5430419D17Rik UTSW 7 131247465 missense possibly damaging 0.86
R4916:5430419D17Rik UTSW 7 131174477 synonymous probably null
R5488:5430419D17Rik UTSW 7 131246595 missense probably damaging 1.00
R5594:5430419D17Rik UTSW 7 131239523 missense probably benign 0.12
R5897:5430419D17Rik UTSW 7 131196551 splice site probably null
R5898:5430419D17Rik UTSW 7 131241967 splice site probably null
R5940:5430419D17Rik UTSW 7 131238263 missense probably damaging 1.00
R6170:5430419D17Rik UTSW 7 131174487 splice site probably null
R6187:5430419D17Rik UTSW 7 131270599 intron probably benign
R6409:5430419D17Rik UTSW 7 131262071 intron probably benign
R6432:5430419D17Rik UTSW 7 131244872 critical splice donor site probably null
R6481:5430419D17Rik UTSW 7 131256801 missense probably benign 0.05
R6750:5430419D17Rik UTSW 7 131288245 intron probably benign
R6783:5430419D17Rik UTSW 7 131226764 missense probably damaging 0.99
R6836:5430419D17Rik UTSW 7 131196504 missense possibly damaging 0.84
R6925:5430419D17Rik UTSW 7 131222707 missense possibly damaging 0.92
Z1088:5430419D17Rik UTSW 7 131246633 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGGGATCTGACAGATGC -3'
(R):5'- CCCTTTACAAATGACTGAACCTAAG -3'

Sequencing Primer
(F):5'- TCTGACAGATGCCAAGGTG -3'
(R):5'- GACTGAACCTAAGGTTGAAAACTAAC -3'
Posted On2018-04-02