Incidental Mutation 'R6326:Msto1'
ID510387
Institutional Source Beutler Lab
Gene Symbol Msto1
Ensembl Gene ENSMUSG00000068922
Gene Namemisato 1, mitochondrial distribution and morphology regulator
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.838) question?
Stock #R6326 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location88905107-88913999 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 88912098 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 149 (V149G)
Ref Sequence ENSEMBL: ENSMUSP00000115645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081695] [ENSMUST00000090942] [ENSMUST00000107494] [ENSMUST00000107498] [ENSMUST00000126245]
Predicted Effect probably benign
Transcript: ENSMUST00000081695
SMART Domains Protein: ENSMUSP00000080397
Gene: ENSMUSG00000054199

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 240 256 N/A INTRINSIC
low complexity region 348 377 N/A INTRINSIC
low complexity region 432 439 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
low complexity region 683 696 N/A INTRINSIC
Blast:SANT 813 865 1e-23 BLAST
low complexity region 961 975 N/A INTRINSIC
low complexity region 1311 1329 N/A INTRINSIC
low complexity region 1418 1434 N/A INTRINSIC
low complexity region 1452 1497 N/A INTRINSIC
low complexity region 1507 1541 N/A INTRINSIC
Pfam:PAH 1652 1700 8.8e-9 PFAM
low complexity region 1800 1811 N/A INTRINSIC
coiled coil region 1919 1943 N/A INTRINSIC
low complexity region 2085 2094 N/A INTRINSIC
SANT 2153 2204 2.2e-1 SMART
low complexity region 2207 2222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090942
SMART Domains Protein: ENSMUSP00000088461
Gene: ENSMUSG00000054199

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 241 257 N/A INTRINSIC
low complexity region 349 378 N/A INTRINSIC
low complexity region 433 440 N/A INTRINSIC
low complexity region 528 543 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
Blast:SANT 814 866 2e-23 BLAST
low complexity region 962 976 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 1419 1435 N/A INTRINSIC
low complexity region 1453 1498 N/A INTRINSIC
low complexity region 1508 1542 N/A INTRINSIC
Pfam:PAH 1654 1700 2.1e-8 PFAM
low complexity region 1801 1812 N/A INTRINSIC
coiled coil region 1920 1944 N/A INTRINSIC
low complexity region 2086 2095 N/A INTRINSIC
SANT 2154 2205 2.2e-1 SMART
low complexity region 2208 2223 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107494
AA Change: V162G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103118
Gene: ENSMUSG00000068922
AA Change: V162G

DomainStartEndE-ValueType
low complexity region 50 63 N/A INTRINSIC
Pfam:Tubulin_3 153 345 5.3e-28 PFAM
Pfam:Tubulin 169 300 7.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107498
SMART Domains Protein: ENSMUSP00000103122
Gene: ENSMUSG00000054199

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 240 256 N/A INTRINSIC
low complexity region 348 377 N/A INTRINSIC
low complexity region 432 439 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
low complexity region 683 696 N/A INTRINSIC
Blast:SANT 813 865 1e-23 BLAST
low complexity region 961 975 N/A INTRINSIC
low complexity region 1311 1329 N/A INTRINSIC
low complexity region 1418 1434 N/A INTRINSIC
low complexity region 1452 1497 N/A INTRINSIC
low complexity region 1507 1541 N/A INTRINSIC
Pfam:PAH 1652 1700 8.8e-9 PFAM
low complexity region 1800 1811 N/A INTRINSIC
coiled coil region 1919 1943 N/A INTRINSIC
low complexity region 2085 2094 N/A INTRINSIC
SANT 2153 2204 2.2e-1 SMART
low complexity region 2207 2222 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000126245
AA Change: V149G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115645
Gene: ENSMUSG00000068922
AA Change: V149G

DomainStartEndE-ValueType
Pfam:Misat_Tub_SegII 6 120 2.1e-36 PFAM
Pfam:Tubulin_3 140 332 1.9e-27 PFAM
Pfam:Tubulin 151 288 8.7e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137243
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147828
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T G 9: 50,764,757 N87T probably damaging Het
2810474O19Rik T A 6: 149,328,995 Y1180N probably damaging Het
Adamts17 A T 7: 67,120,888 Y915F probably benign Het
Adap2 T A 11: 80,155,022 F43I probably damaging Het
Adprhl2 A T 4: 126,316,613 L358Q possibly damaging Het
AI314180 T A 4: 58,827,068 T1022S probably benign Het
Akap9 A C 5: 3,962,061 Q921H probably damaging Het
Amigo2 A G 15: 97,245,375 S389P probably benign Het
Atg2b A T 12: 105,661,092 C545* probably null Het
C2cd3 A G 7: 100,416,428 E807G probably benign Het
Ccdc110 A G 8: 45,942,041 E323G probably damaging Het
Cdk5rap2 T A 4: 70,235,454 S1711C probably damaging Het
Cebpzos T G 17: 78,919,057 D39E probably damaging Het
Cenpe A G 3: 135,239,778 N1018D probably benign Het
Clspn C A 4: 126,565,739 H141Q probably damaging Het
Cluh C T 11: 74,666,242 A1010V probably benign Het
Col27a1 G T 4: 63,324,441 probably benign Het
Cpt2 T C 4: 107,914,316 M61V probably benign Het
Ddr2 T A 1: 169,987,140 H578L probably damaging Het
Dnah14 T A 1: 181,783,556 I3749N probably damaging Het
Dnajc18 T C 18: 35,680,925 T264A possibly damaging Het
Eml6 T C 11: 29,819,066 N693S probably damaging Het
Ephx4 A G 5: 107,406,111 E9G probably damaging Het
Eps15l1 G A 8: 72,341,434 Q747* probably null Het
Flrt1 C T 19: 7,096,609 S191N probably damaging Het
Gm5114 C T 7: 39,408,155 R680H probably benign Het
Gm5431 T C 11: 48,889,345 H250R probably damaging Het
Gm7233 T C 14: 43,182,885 C198R possibly damaging Het
Herc2 C G 7: 56,222,934 Q4407E probably damaging Het
Hmx3 C G 7: 131,543,005 probably benign Het
Hoxb7 C A 11: 96,287,083 A119E probably benign Het
Ifi207 A T 1: 173,729,966 M402K probably benign Het
Ints14 T C 9: 64,964,437 V19A probably benign Het
Itgae T A 11: 73,131,693 N911K possibly damaging Het
Kif1a T C 1: 93,076,326 S145G probably damaging Het
Klhdc4 A G 8: 121,805,054 W187R probably damaging Het
Krt1 A T 15: 101,850,249 I160N probably damaging Het
Krt12 T C 11: 99,416,919 T448A probably benign Het
Lcmt2 G A 2: 121,139,457 R382* probably null Het
Map3k8 C T 18: 4,340,651 S221N probably damaging Het
Med17 T C 9: 15,279,558 D79G probably benign Het
Mlf1 A T 3: 67,399,727 I257F probably damaging Het
Mov10l1 T A 15: 88,994,895 F153I probably damaging Het
Mybl1 T C 1: 9,678,507 probably null Het
Myoc A G 1: 162,649,011 Y428C probably damaging Het
Nin A G 12: 70,045,181 S785P possibly damaging Het
Oit3 A T 10: 59,428,239 F358I probably damaging Het
Olfr1095 C T 2: 86,850,994 V235I probably benign Het
Olfr794 A G 10: 129,570,702 T16A possibly damaging Het
Paip1 A G 13: 119,430,217 N29S probably benign Het
Pcdhgb4 T C 18: 37,722,456 S635P probably benign Het
Pcsk1 A G 13: 75,132,179 N708D possibly damaging Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Prag1 A T 8: 36,102,706 M148L possibly damaging Het
Ptch1 A G 13: 63,543,545 L176P probably damaging Het
Ralgapa1 A T 12: 55,747,146 V568D probably damaging Het
Rb1 A T 14: 73,198,534 M897K probably benign Het
Robo3 T A 9: 37,427,027 Q386L probably damaging Het
Rtn4rl1 T C 11: 75,266,002 V420A possibly damaging Het
Sall1 A T 8: 89,030,268 N1069K probably benign Het
Sipa1l1 A G 12: 82,372,468 E640G probably damaging Het
Slc22a2 C A 17: 12,612,410 Y362* probably null Het
Slc5a9 T C 4: 111,880,253 E603G probably benign Het
Slc6a17 A T 3: 107,500,406 I83N probably damaging Het
Snx29 G T 16: 11,403,566 M285I probably benign Het
Spata2 T C 2: 167,484,174 T242A possibly damaging Het
Stard13 A G 5: 151,046,919 L733P possibly damaging Het
Svep1 A G 4: 58,073,045 V2088A possibly damaging Het
Tdp2 A G 13: 24,840,557 E279G probably damaging Het
Tnfrsf8 T G 4: 145,269,224 I422L probably damaging Het
Tpk1 T A 6: 43,346,802 T189S possibly damaging Het
Trhde A T 10: 114,567,224 M498K probably damaging Het
Trim35 T A 14: 66,303,204 H168Q possibly damaging Het
Tubb5 T C 17: 35,836,455 probably benign Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Vmn2r77 G A 7: 86,801,823 G306R probably benign Het
Xkr4 C T 1: 3,671,038 R104H possibly damaging Het
Zcchc11 C T 4: 108,478,980 T6I probably benign Het
Zfp398 T C 6: 47,866,421 I337T possibly damaging Het
Other mutations in Msto1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Msto1 APN 3 88913686 missense probably benign 0.12
IGL01309:Msto1 APN 3 88913686 missense probably benign 0.12
IGL01327:Msto1 APN 3 88910632 unclassified probably null
IGL01505:Msto1 APN 3 88910743 missense probably benign 0.00
IGL01914:Msto1 APN 3 88912903 missense probably benign 0.39
IGL02292:Msto1 APN 3 88911824 missense probably benign 0.20
IGL02349:Msto1 APN 3 88910898 missense possibly damaging 0.95
IGL02510:Msto1 APN 3 88910345 missense probably damaging 1.00
IGL03120:Msto1 APN 3 88910809 missense probably damaging 1.00
R0041:Msto1 UTSW 3 88910235 missense probably damaging 0.97
R0110:Msto1 UTSW 3 88911541 missense probably benign 0.02
R0282:Msto1 UTSW 3 88911577 missense possibly damaging 0.91
R0384:Msto1 UTSW 3 88910339 nonsense probably null
R0450:Msto1 UTSW 3 88911541 missense probably benign 0.02
R0469:Msto1 UTSW 3 88911541 missense probably benign 0.02
R0510:Msto1 UTSW 3 88911541 missense probably benign 0.02
R2088:Msto1 UTSW 3 88910990 missense probably damaging 1.00
R2516:Msto1 UTSW 3 88911893 splice site probably null
R4897:Msto1 UTSW 3 88912252 missense probably benign 0.02
R5661:Msto1 UTSW 3 88912885 missense possibly damaging 0.66
R6179:Msto1 UTSW 3 88910947 missense probably damaging 1.00
R6395:Msto1 UTSW 3 88905474 missense possibly damaging 0.77
R7039:Msto1 UTSW 3 88911390 missense probably damaging 0.96
R7399:Msto1 UTSW 3 88911823 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAGTCTGCTGTTCTGGAG -3'
(R):5'- TGGCGGACGAAAACAACCTG -3'

Sequencing Primer
(F):5'- CTGCTGTTCTGGAGGGCAG -3'
(R):5'- TGGAACTAAAATCTTCTCACCCCTC -3'
Posted On2018-04-02