Incidental Mutation 'R6326:Itgae'
ID510427
Institutional Source Beutler Lab
Gene Symbol Itgae
Ensembl Gene ENSMUSG00000005947
Gene Nameintegrin alpha E, epithelial-associated
SynonymsCD103, alpha-E1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6326 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location73090583-73147446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73131693 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 911 (N911K)
Ref Sequence ENSEMBL: ENSMUSP00000099596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006101] [ENSMUST00000052140] [ENSMUST00000102537]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006101
AA Change: N911K

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000006101
Gene: ENSMUSG00000005947
AA Change: N911K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:Int_alpha 36 118 1e-24 BLAST
VWA 193 380 1.13e-39 SMART
Int_alpha 448 496 1.49e-3 SMART
Int_alpha 502 559 6.83e-12 SMART
Int_alpha 565 626 1.79e-15 SMART
Int_alpha 633 685 6.29e0 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 1.1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052140
SMART Domains Protein: ENSMUSP00000055806
Gene: ENSMUSG00000050107

DomainStartEndE-ValueType
low complexity region 61 67 N/A INTRINSIC
low complexity region 74 89 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
low complexity region 357 378 N/A INTRINSIC
SCOP:d1h8fa_ 437 619 1e-8 SMART
DUF3635 664 753 3.83e-45 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102537
AA Change: N911K

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099596
Gene: ENSMUSG00000005947
AA Change: N911K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:Int_alpha 36 118 5e-25 BLAST
VWA 193 380 1.13e-39 SMART
Int_alpha 448 496 1.49e-3 SMART
Int_alpha 502 559 6.83e-12 SMART
Int_alpha 565 626 1.79e-15 SMART
Int_alpha 633 685 6.29e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes an I-domain-containing alpha integrin that undergoes post-translational cleavage in the extracellular domain, yielding disulfide-linked heavy and light chains. In combination with the beta 7 integrin, this protein forms the E-cadherin binding integrin known as the human mucosal lymphocyte-1 antigen. This protein is preferentially expressed in human intestinal intraepithelial lymphocytes (IEL), and in addition to a role in adhesion, it may serve as an accessory molecule for IEL activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reductions in the numbers of intestinal and vaginal intraepithelial lymphocytes and of T lymphocytes of the lamina propria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T G 9: 50,764,757 N87T probably damaging Het
2810474O19Rik T A 6: 149,328,995 Y1180N probably damaging Het
Adamts17 A T 7: 67,120,888 Y915F probably benign Het
Adap2 T A 11: 80,155,022 F43I probably damaging Het
Adprhl2 A T 4: 126,316,613 L358Q possibly damaging Het
AI314180 T A 4: 58,827,068 T1022S probably benign Het
Akap9 A C 5: 3,962,061 Q921H probably damaging Het
Amigo2 A G 15: 97,245,375 S389P probably benign Het
Atg2b A T 12: 105,661,092 C545* probably null Het
C2cd3 A G 7: 100,416,428 E807G probably benign Het
Ccdc110 A G 8: 45,942,041 E323G probably damaging Het
Cdk5rap2 T A 4: 70,235,454 S1711C probably damaging Het
Cebpzos T G 17: 78,919,057 D39E probably damaging Het
Cenpe A G 3: 135,239,778 N1018D probably benign Het
Clspn C A 4: 126,565,739 H141Q probably damaging Het
Cluh C T 11: 74,666,242 A1010V probably benign Het
Col27a1 G T 4: 63,324,441 probably benign Het
Cpt2 T C 4: 107,914,316 M61V probably benign Het
Ddr2 T A 1: 169,987,140 H578L probably damaging Het
Dnah14 T A 1: 181,783,556 I3749N probably damaging Het
Dnajc18 T C 18: 35,680,925 T264A possibly damaging Het
Eml6 T C 11: 29,819,066 N693S probably damaging Het
Ephx4 A G 5: 107,406,111 E9G probably damaging Het
Eps15l1 G A 8: 72,341,434 Q747* probably null Het
Flrt1 C T 19: 7,096,609 S191N probably damaging Het
Gm5114 C T 7: 39,408,155 R680H probably benign Het
Gm5431 T C 11: 48,889,345 H250R probably damaging Het
Gm7233 T C 14: 43,182,885 C198R possibly damaging Het
Herc2 C G 7: 56,222,934 Q4407E probably damaging Het
Hmx3 C G 7: 131,543,005 probably benign Het
Hoxb7 C A 11: 96,287,083 A119E probably benign Het
Ifi207 A T 1: 173,729,966 M402K probably benign Het
Ints14 T C 9: 64,964,437 V19A probably benign Het
Kif1a T C 1: 93,076,326 S145G probably damaging Het
Klhdc4 A G 8: 121,805,054 W187R probably damaging Het
Krt1 A T 15: 101,850,249 I160N probably damaging Het
Krt12 T C 11: 99,416,919 T448A probably benign Het
Lcmt2 G A 2: 121,139,457 R382* probably null Het
Map3k8 C T 18: 4,340,651 S221N probably damaging Het
Med17 T C 9: 15,279,558 D79G probably benign Het
Mlf1 A T 3: 67,399,727 I257F probably damaging Het
Mov10l1 T A 15: 88,994,895 F153I probably damaging Het
Msto1 A C 3: 88,912,098 V149G probably damaging Het
Mybl1 T C 1: 9,678,507 probably null Het
Myoc A G 1: 162,649,011 Y428C probably damaging Het
Nin A G 12: 70,045,181 S785P possibly damaging Het
Oit3 A T 10: 59,428,239 F358I probably damaging Het
Olfr1095 C T 2: 86,850,994 V235I probably benign Het
Olfr794 A G 10: 129,570,702 T16A possibly damaging Het
Paip1 A G 13: 119,430,217 N29S probably benign Het
Pcdhgb4 T C 18: 37,722,456 S635P probably benign Het
Pcsk1 A G 13: 75,132,179 N708D possibly damaging Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Prag1 A T 8: 36,102,706 M148L possibly damaging Het
Ptch1 A G 13: 63,543,545 L176P probably damaging Het
Ralgapa1 A T 12: 55,747,146 V568D probably damaging Het
Rb1 A T 14: 73,198,534 M897K probably benign Het
Robo3 T A 9: 37,427,027 Q386L probably damaging Het
Rtn4rl1 T C 11: 75,266,002 V420A possibly damaging Het
Sall1 A T 8: 89,030,268 N1069K probably benign Het
Sipa1l1 A G 12: 82,372,468 E640G probably damaging Het
Slc22a2 C A 17: 12,612,410 Y362* probably null Het
Slc5a9 T C 4: 111,880,253 E603G probably benign Het
Slc6a17 A T 3: 107,500,406 I83N probably damaging Het
Snx29 G T 16: 11,403,566 M285I probably benign Het
Spata2 T C 2: 167,484,174 T242A possibly damaging Het
Stard13 A G 5: 151,046,919 L733P possibly damaging Het
Svep1 A G 4: 58,073,045 V2088A possibly damaging Het
Tdp2 A G 13: 24,840,557 E279G probably damaging Het
Tnfrsf8 T G 4: 145,269,224 I422L probably damaging Het
Tpk1 T A 6: 43,346,802 T189S possibly damaging Het
Trhde A T 10: 114,567,224 M498K probably damaging Het
Trim35 T A 14: 66,303,204 H168Q possibly damaging Het
Tubb5 T C 17: 35,836,455 probably benign Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Vmn2r77 G A 7: 86,801,823 G306R probably benign Het
Xkr4 C T 1: 3,671,038 R104H possibly damaging Het
Zcchc11 C T 4: 108,478,980 T6I probably benign Het
Zfp398 T C 6: 47,866,421 I337T possibly damaging Het
Other mutations in Itgae
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Itgae APN 11 73145635 missense probably benign 0.17
IGL00472:Itgae APN 11 73113694 missense probably benign 0.06
IGL00821:Itgae APN 11 73123148 missense probably damaging 1.00
IGL01625:Itgae APN 11 73119437 missense probably benign 0.00
IGL01639:Itgae APN 11 73119378 missense probably benign 0.00
IGL01743:Itgae APN 11 73111759 missense probably benign 0.02
IGL01911:Itgae APN 11 73116137 missense probably damaging 1.00
IGL01949:Itgae APN 11 73118184 missense probably benign 0.29
IGL02149:Itgae APN 11 73103894 missense probably benign 0.04
IGL02179:Itgae APN 11 73134018 missense probably benign 0.06
IGL02231:Itgae APN 11 73090622 missense possibly damaging 0.88
IGL02292:Itgae APN 11 73118535 missense probably damaging 0.98
IGL02378:Itgae APN 11 73118121 missense probably benign 0.00
IGL02525:Itgae APN 11 73130951 missense probably damaging 0.98
IGL02576:Itgae APN 11 73118505 missense possibly damaging 0.95
IGL02729:Itgae APN 11 73118203 splice site probably benign
IGL02859:Itgae APN 11 73114867 missense probably damaging 1.00
IGL03074:Itgae APN 11 73125310 missense probably benign 0.00
IGL03107:Itgae APN 11 73113601 missense probably damaging 1.00
IGL03264:Itgae APN 11 73115574 missense possibly damaging 0.73
IGL03272:Itgae APN 11 73133854 unclassified probably null
IGL03352:Itgae APN 11 73131730 missense probably damaging 1.00
R0134:Itgae UTSW 11 73111342 missense probably benign 0.00
R0225:Itgae UTSW 11 73111342 missense probably benign 0.00
R0320:Itgae UTSW 11 73130999 missense possibly damaging 0.74
R0344:Itgae UTSW 11 73118147 missense probably benign 0.13
R0403:Itgae UTSW 11 73123183 missense possibly damaging 0.89
R0631:Itgae UTSW 11 73114907 missense probably damaging 1.00
R0833:Itgae UTSW 11 73129206 missense probably benign 0.02
R0836:Itgae UTSW 11 73129206 missense probably benign 0.02
R0973:Itgae UTSW 11 73138509 nonsense probably null
R1231:Itgae UTSW 11 73119379 missense probably benign 0.02
R1389:Itgae UTSW 11 73125362 missense probably damaging 1.00
R1433:Itgae UTSW 11 73115592 missense probably damaging 1.00
R1534:Itgae UTSW 11 73145605 missense possibly damaging 0.58
R1833:Itgae UTSW 11 73117162 missense possibly damaging 0.94
R1914:Itgae UTSW 11 73118643 splice site probably benign
R1915:Itgae UTSW 11 73118643 splice site probably benign
R2061:Itgae UTSW 11 73118622 missense probably benign 0.00
R2380:Itgae UTSW 11 73145569 missense probably benign 0.00
R2435:Itgae UTSW 11 73121937 nonsense probably null
R2680:Itgae UTSW 11 73114926 missense probably damaging 1.00
R2886:Itgae UTSW 11 73140687 missense probably benign 0.04
R3873:Itgae UTSW 11 73113616 missense probably damaging 1.00
R3923:Itgae UTSW 11 73116143 missense probably damaging 0.99
R4010:Itgae UTSW 11 73111339 missense probably benign 0.00
R4059:Itgae UTSW 11 73112134 missense probably benign
R4212:Itgae UTSW 11 73119352 missense probably benign
R4213:Itgae UTSW 11 73119352 missense probably benign
R4691:Itgae UTSW 11 73119519 nonsense probably null
R4736:Itgae UTSW 11 73114880 missense possibly damaging 0.79
R5152:Itgae UTSW 11 73130995 missense probably damaging 1.00
R5201:Itgae UTSW 11 73110556 missense probably benign 0.00
R5307:Itgae UTSW 11 73145638 missense probably benign 0.00
R5362:Itgae UTSW 11 73111849 missense probably damaging 1.00
R5448:Itgae UTSW 11 73133908 critical splice donor site probably null
R5645:Itgae UTSW 11 73129248 missense probably damaging 1.00
R5672:Itgae UTSW 11 73145551 missense possibly damaging 0.96
R6079:Itgae UTSW 11 73115574 missense possibly damaging 0.73
R6138:Itgae UTSW 11 73115574 missense possibly damaging 0.73
R6226:Itgae UTSW 11 73140757 missense probably benign 0.11
R6244:Itgae UTSW 11 73145601 missense probably damaging 0.96
R6332:Itgae UTSW 11 73111402 splice site probably null
R6502:Itgae UTSW 11 73145592 missense probably benign 0.10
R6825:Itgae UTSW 11 73118496 missense possibly damaging 0.89
R7016:Itgae UTSW 11 73119516 missense probably damaging 0.99
R7020:Itgae UTSW 11 73111369 missense probably damaging 1.00
R7069:Itgae UTSW 11 73116143 missense probably damaging 0.99
R7132:Itgae UTSW 11 73111358 missense possibly damaging 0.93
U15987:Itgae UTSW 11 73115574 missense possibly damaging 0.73
X0024:Itgae UTSW 11 73111376 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCTAATGCTGCTTAGCCACAG -3'
(R):5'- CAGAATATCCCCTAGTGTTCCTTTG -3'

Sequencing Primer
(F):5'- TGGGCTATATCCTGATCAGCAAGC -3'
(R):5'- ATATCCCCTAGTGTTCCTTTGTATGG -3'
Posted On2018-04-02