Incidental Mutation 'R6326:Flrt1'
ID510454
Institutional Source Beutler Lab
Gene Symbol Flrt1
Ensembl Gene ENSMUSG00000047787
Gene Namefibronectin leucine rich transmembrane protein 1
SynonymsD630040I23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.227) question?
Stock #R6326 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location7092014-7105729 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 7096609 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 191 (S191N)
Ref Sequence ENSEMBL: ENSMUSP00000109010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040261] [ENSMUST00000113383]
Predicted Effect probably benign
Transcript: ENSMUST00000040261
SMART Domains Protein: ENSMUSP00000039507
Gene: ENSMUSG00000036278

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
low complexity region 25 41 N/A INTRINSIC
low complexity region 59 74 N/A INTRINSIC
A1pp 151 281 7.67e-46 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113383
AA Change: S191N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109010
Gene: ENSMUSG00000047787
AA Change: S191N

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
LRRNT 53 85 4.11e-6 SMART
LRR 127 149 2.61e1 SMART
LRR 150 175 4.71e1 SMART
LRR 177 199 1.76e1 SMART
LRR 200 220 7.36e0 SMART
LRR 221 246 1.49e1 SMART
LRR 247 270 9.77e1 SMART
LRR 271 292 1.53e1 SMART
LRR_TYP 293 316 3.55e-6 SMART
LRRCT 328 379 5.19e-9 SMART
low complexity region 381 392 N/A INTRINSIC
FN3 434 515 1.49e0 SMART
transmembrane domain 556 578 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fibronectin leucine rich transmembrane protein (FLRT) family. The family members may function in cell adhesion and/or receptor signalling. Their protein structures resemble small leucine-rich proteoglycans found in the extracellular matrix. The encoded protein shares sequence similarity with two other family members, FLRT2 and FLRT3. This gene is expressed in kidney and brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: No notable phenotype was detected in a high-throughput screen of homozygous mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T G 9: 50,764,757 N87T probably damaging Het
2810474O19Rik T A 6: 149,328,995 Y1180N probably damaging Het
Adamts17 A T 7: 67,120,888 Y915F probably benign Het
Adap2 T A 11: 80,155,022 F43I probably damaging Het
Adprhl2 A T 4: 126,316,613 L358Q possibly damaging Het
AI314180 T A 4: 58,827,068 T1022S probably benign Het
Akap9 A C 5: 3,962,061 Q921H probably damaging Het
Amigo2 A G 15: 97,245,375 S389P probably benign Het
Atg2b A T 12: 105,661,092 C545* probably null Het
C2cd3 A G 7: 100,416,428 E807G probably benign Het
Ccdc110 A G 8: 45,942,041 E323G probably damaging Het
Cdk5rap2 T A 4: 70,235,454 S1711C probably damaging Het
Cebpzos T G 17: 78,919,057 D39E probably damaging Het
Cenpe A G 3: 135,239,778 N1018D probably benign Het
Clspn C A 4: 126,565,739 H141Q probably damaging Het
Cluh C T 11: 74,666,242 A1010V probably benign Het
Col27a1 G T 4: 63,324,441 probably benign Het
Cpt2 T C 4: 107,914,316 M61V probably benign Het
Ddr2 T A 1: 169,987,140 H578L probably damaging Het
Dnah14 T A 1: 181,783,556 I3749N probably damaging Het
Dnajc18 T C 18: 35,680,925 T264A possibly damaging Het
Eml6 T C 11: 29,819,066 N693S probably damaging Het
Ephx4 A G 5: 107,406,111 E9G probably damaging Het
Eps15l1 G A 8: 72,341,434 Q747* probably null Het
Gm5114 C T 7: 39,408,155 R680H probably benign Het
Gm5431 T C 11: 48,889,345 H250R probably damaging Het
Gm7233 T C 14: 43,182,885 C198R possibly damaging Het
Herc2 C G 7: 56,222,934 Q4407E probably damaging Het
Hmx3 C G 7: 131,543,005 probably benign Het
Hoxb7 C A 11: 96,287,083 A119E probably benign Het
Ifi207 A T 1: 173,729,966 M402K probably benign Het
Ints14 T C 9: 64,964,437 V19A probably benign Het
Itgae T A 11: 73,131,693 N911K possibly damaging Het
Kif1a T C 1: 93,076,326 S145G probably damaging Het
Klhdc4 A G 8: 121,805,054 W187R probably damaging Het
Krt1 A T 15: 101,850,249 I160N probably damaging Het
Krt12 T C 11: 99,416,919 T448A probably benign Het
Lcmt2 G A 2: 121,139,457 R382* probably null Het
Map3k8 C T 18: 4,340,651 S221N probably damaging Het
Med17 T C 9: 15,279,558 D79G probably benign Het
Mlf1 A T 3: 67,399,727 I257F probably damaging Het
Mov10l1 T A 15: 88,994,895 F153I probably damaging Het
Msto1 A C 3: 88,912,098 V149G probably damaging Het
Mybl1 T C 1: 9,678,507 probably null Het
Myoc A G 1: 162,649,011 Y428C probably damaging Het
Nin A G 12: 70,045,181 S785P possibly damaging Het
Oit3 A T 10: 59,428,239 F358I probably damaging Het
Olfr1095 C T 2: 86,850,994 V235I probably benign Het
Olfr794 A G 10: 129,570,702 T16A possibly damaging Het
Paip1 A G 13: 119,430,217 N29S probably benign Het
Pcdhgb4 T C 18: 37,722,456 S635P probably benign Het
Pcsk1 A G 13: 75,132,179 N708D possibly damaging Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Prag1 A T 8: 36,102,706 M148L possibly damaging Het
Ptch1 A G 13: 63,543,545 L176P probably damaging Het
Ralgapa1 A T 12: 55,747,146 V568D probably damaging Het
Rb1 A T 14: 73,198,534 M897K probably benign Het
Robo3 T A 9: 37,427,027 Q386L probably damaging Het
Rtn4rl1 T C 11: 75,266,002 V420A possibly damaging Het
Sall1 A T 8: 89,030,268 N1069K probably benign Het
Sipa1l1 A G 12: 82,372,468 E640G probably damaging Het
Slc22a2 C A 17: 12,612,410 Y362* probably null Het
Slc5a9 T C 4: 111,880,253 E603G probably benign Het
Slc6a17 A T 3: 107,500,406 I83N probably damaging Het
Snx29 G T 16: 11,403,566 M285I probably benign Het
Spata2 T C 2: 167,484,174 T242A possibly damaging Het
Stard13 A G 5: 151,046,919 L733P possibly damaging Het
Svep1 A G 4: 58,073,045 V2088A possibly damaging Het
Tdp2 A G 13: 24,840,557 E279G probably damaging Het
Tnfrsf8 T G 4: 145,269,224 I422L probably damaging Het
Tpk1 T A 6: 43,346,802 T189S possibly damaging Het
Trhde A T 10: 114,567,224 M498K probably damaging Het
Trim35 T A 14: 66,303,204 H168Q possibly damaging Het
Tubb5 T C 17: 35,836,455 probably benign Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Vmn2r77 G A 7: 86,801,823 G306R probably benign Het
Xkr4 C T 1: 3,671,038 R104H possibly damaging Het
Zcchc11 C T 4: 108,478,980 T6I probably benign Het
Zfp398 T C 6: 47,866,421 I337T possibly damaging Het
Other mutations in Flrt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Flrt1 APN 19 7096912 missense probably damaging 1.00
IGL01082:Flrt1 APN 19 7095974 missense probably benign
IGL02535:Flrt1 APN 19 7096733 missense probably benign 0.00
R0240:Flrt1 UTSW 19 7097110 intron probably benign
R0240:Flrt1 UTSW 19 7097110 intron probably benign
R0403:Flrt1 UTSW 19 7095919 missense probably benign 0.01
R0645:Flrt1 UTSW 19 7097143 intron probably benign
R0677:Flrt1 UTSW 19 7096179 nonsense probably null
R1818:Flrt1 UTSW 19 7095346 missense probably damaging 1.00
R2191:Flrt1 UTSW 19 7095829 missense probably damaging 0.99
R2228:Flrt1 UTSW 19 7095358 missense probably damaging 1.00
R2471:Flrt1 UTSW 19 7096491 missense probably damaging 1.00
R4978:Flrt1 UTSW 19 7096876 missense probably damaging 1.00
R5460:Flrt1 UTSW 19 7095740 missense probably damaging 0.99
R5630:Flrt1 UTSW 19 7096465 missense probably damaging 1.00
R6734:Flrt1 UTSW 19 7096159 missense possibly damaging 0.91
R6905:Flrt1 UTSW 19 7095392 nonsense probably null
R7239:Flrt1 UTSW 19 7095964 missense probably benign 0.12
X0024:Flrt1 UTSW 19 7095749 missense probably damaging 1.00
X0062:Flrt1 UTSW 19 7096879 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTTCCGTACTAGCGACAGC -3'
(R):5'- ATGACCTGGACGAGTTCCCTATC -3'

Sequencing Primer
(F):5'- CGTGAGGTTCTGCAGCC -3'
(R):5'- TCCCTGAGAGAGCTGCATCTG -3'
Posted On2018-04-02