Incidental Mutation 'R6313:Myom1'
ID510558
Institutional Source Beutler Lab
Gene Symbol Myom1
Ensembl Gene ENSMUSG00000024049
Gene Namemyomesin 1
Synonymsskelemin, D430047A17Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R6313 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location71019521-71126856 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71082488 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 911 (D911V)
Ref Sequence ENSEMBL: ENSMUSP00000072945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024847] [ENSMUST00000073211] [ENSMUST00000179759]
PDB Structure
Skelemin Immunoglobulin C2 like domain 4 [SOLUTION NMR]
Skelemin Association with alfa2b,betta3 Integrin: A Structural Model [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000024847
SMART Domains Protein: ENSMUSP00000024847
Gene: ENSMUSG00000024049

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073211
AA Change: D911V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072945
Gene: ENSMUSG00000024049
AA Change: D911V

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
low complexity region 857 870 N/A INTRINSIC
FN3 916 1002 4.99e-11 SMART
FN3 1021 1106 2.04e-16 SMART
IG 1123 1208 3.1e0 SMART
IG_like 1231 1317 1.34e1 SMART
IG_like 1351 1417 4.79e0 SMART
IG_like 1454 1531 1.54e2 SMART
IGc2 1567 1635 2.05e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179759
SMART Domains Protein: ENSMUSP00000136266
Gene: ENSMUSG00000024049

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180743
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD (myomesin 1) and 165 kD (myomesin 2). This protein, myomesin 1, like myomesin 2, titin, and other myofibrillar proteins contains structural modules with strong homology to either fibronectin type III (motif I) or immunoglobulin C2 (motif II) domains. Myomesin 1 and myomesin 2 each have a unique N-terminal region followed by 12 modules of motif I or motif II, in the arrangement II-II-I-I-I-I-I-II-II-II-II-II. The two proteins share 50% sequence identity in this repeat-containing region. The head structure formed by these 2 proteins on one end of the titin string extends into the center of the M band. The integrating structure of the sarcomere arises from muscle-specific members of the superfamily of immunoglobulin-like proteins. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik C T 9: 51,290,181 D192N probably damaging Het
4932415D10Rik T C 10: 82,293,636 N1180S probably benign Het
Abca16 T C 7: 120,527,121 F1167L probably damaging Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
Acaca C T 11: 84,292,929 T32I probably benign Het
Adam6a A T 12: 113,545,050 N348Y possibly damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arhgef38 T C 3: 133,234,708 D39G possibly damaging Het
Arid5b T C 10: 68,097,582 D587G possibly damaging Het
Brwd1 A G 16: 96,007,941 V1963A probably benign Het
Ccdc136 T A 6: 29,410,205 L34Q probably damaging Het
Cdh2 T C 18: 16,774,522 Q53R probably benign Het
Celsr2 G A 3: 108,401,214 S1799L probably damaging Het
Cenpe A G 3: 135,230,175 E457G probably benign Het
Cmtm1 A T 8: 104,305,163 M283K possibly damaging Het
Dcdc5 T C 2: 106,368,171 noncoding transcript Het
Decr1 T A 4: 15,924,261 M220L probably benign Het
Dgkg T G 16: 22,519,561 D592A probably damaging Het
Dkkl1 T C 7: 45,211,438 Q39R probably benign Het
Dyrk1a T A 16: 94,659,514 C10S probably damaging Het
Efcab2 A T 1: 178,481,371 E146D probably benign Het
Efhc1 T C 1: 20,979,428 V504A possibly damaging Het
Ermard T G 17: 15,053,205 probably null Het
Espl1 T C 15: 102,315,812 V1266A probably benign Het
Fbxw22 A C 9: 109,403,397 V40G probably damaging Het
Gm3460 A T 14: 6,619,410 I194N possibly damaging Het
Gnai2 C T 9: 107,620,097 V33M possibly damaging Het
H2-DMb1 T C 17: 34,157,532 probably null Het
Hc T C 2: 34,989,839 probably null Het
Iars T C 13: 49,708,445 S491P probably damaging Het
Knl1 T A 2: 119,069,318 L500H probably damaging Het
Lamb1 A T 12: 31,269,147 T102S probably damaging Het
Lrrc7 A G 3: 158,160,736 S1123P probably damaging Het
Mettl5 C A 2: 69,871,727 probably null Het
Mmp11 A G 10: 75,923,984 *4R probably null Het
Nid1 A G 13: 13,463,782 T96A probably benign Het
Nlrp4e G T 7: 23,353,172 V839L probably benign Het
Notch3 A T 17: 32,151,154 probably null Het
Olfr1082 T C 2: 86,594,067 T254A possibly damaging Het
Pcdh8 T C 14: 79,767,651 H978R probably benign Het
Pde8b A T 13: 95,042,000 C537* probably null Het
Polr1b T C 2: 129,125,446 F920L probably damaging Het
Polr2f A G 15: 79,151,373 T87A probably damaging Het
Pon2 T A 6: 5,272,421 H133L probably damaging Het
Ptk2b T A 14: 66,178,831 E205V probably damaging Het
Rb1cc1 T A 1: 6,244,133 M343K probably benign Het
Rlf G A 4: 121,148,610 R1058W probably damaging Het
S100z T A 13: 95,478,574 K28* probably null Het
Scarf1 T A 11: 75,520,315 N273K probably benign Het
Setd2 A G 9: 110,556,366 I136M unknown Het
Sfrp2 A G 3: 83,766,984 D148G probably benign Het
Slc24a4 A G 12: 102,254,510 E400G probably benign Het
Slc2a9 T G 5: 38,453,121 I112L probably benign Het
Smc5 A T 19: 23,208,948 Y972* probably null Het
Sntg1 T C 1: 8,445,024 probably null Het
Stag1 A G 9: 100,757,733 D114G probably damaging Het
Suclg1 T C 6: 73,256,209 S46P probably damaging Het
Synj1 C T 16: 90,946,815 A1186T probably benign Het
Tas2r124 A G 6: 132,755,447 T240A probably benign Het
Tax1bp1 T C 6: 52,744,356 probably null Het
Tchh C A 3: 93,447,851 Q1533K unknown Het
Tmprss15 T C 16: 78,962,170 T887A probably benign Het
Ttn T C 2: 76,706,593 I34963V probably benign Het
Unc79 G A 12: 103,112,619 G1485D probably damaging Het
Usp9y G T Y: 1,385,355 H633N probably benign Homo
Vmn2r99 A T 17: 19,382,605 N541Y probably damaging Het
Zbtb11 T A 16: 55,990,491 N337K probably benign Het
Zfp260 T A 7: 30,104,842 C56S possibly damaging Het
Zfp457 C T 13: 67,292,682 E610K probably damaging Het
Other mutations in Myom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Myom1 APN 17 71126098 missense probably damaging 1.00
IGL00845:Myom1 APN 17 71084429 missense probably damaging 1.00
IGL00904:Myom1 APN 17 71099949 splice site probably benign
IGL00928:Myom1 APN 17 71089913 missense probably damaging 1.00
IGL01025:Myom1 APN 17 71077917 missense probably damaging 1.00
IGL01548:Myom1 APN 17 71101220 splice site probably benign
IGL01588:Myom1 APN 17 71117437 missense possibly damaging 0.94
IGL01614:Myom1 APN 17 71126178 missense possibly damaging 0.46
IGL01618:Myom1 APN 17 71099993 missense possibly damaging 0.87
IGL01619:Myom1 APN 17 71044476 splice site probably benign
IGL01766:Myom1 APN 17 71077288 missense probably damaging 1.00
IGL02105:Myom1 APN 17 71047716 splice site probably benign
IGL02122:Myom1 APN 17 71092137 missense probably damaging 1.00
IGL02184:Myom1 APN 17 71072137 missense possibly damaging 0.93
IGL02260:Myom1 APN 17 71108315 nonsense probably null
IGL02486:Myom1 APN 17 71099944 splice site probably benign
IGL02501:Myom1 APN 17 71072081 critical splice acceptor site probably null
IGL02642:Myom1 APN 17 71101098 missense possibly damaging 0.90
IGL02677:Myom1 APN 17 71084349 missense probably damaging 1.00
IGL02719:Myom1 APN 17 71106354 splice site probably benign
IGL02945:Myom1 APN 17 71092093 splice site probably benign
IGL03086:Myom1 APN 17 71108671 missense probably damaging 1.00
IGL03218:Myom1 APN 17 71084316 missense possibly damaging 0.46
R0107:Myom1 UTSW 17 71077365 missense probably damaging 1.00
R0130:Myom1 UTSW 17 71045755 missense probably damaging 0.98
R0133:Myom1 UTSW 17 71047787 missense probably damaging 1.00
R0206:Myom1 UTSW 17 71037297 missense probably damaging 1.00
R0206:Myom1 UTSW 17 71037297 missense probably damaging 1.00
R0352:Myom1 UTSW 17 71045749 missense possibly damaging 0.72
R0396:Myom1 UTSW 17 71034693 missense probably damaging 1.00
R0496:Myom1 UTSW 17 71084306 missense probably damaging 1.00
R0506:Myom1 UTSW 17 71092220 splice site probably benign
R0511:Myom1 UTSW 17 71084317 missense probably benign 0.22
R0600:Myom1 UTSW 17 71120648 missense possibly damaging 0.48
R0699:Myom1 UTSW 17 71067313 missense probably damaging 0.98
R0791:Myom1 UTSW 17 71121136 missense probably damaging 1.00
R0792:Myom1 UTSW 17 71121136 missense probably damaging 1.00
R0963:Myom1 UTSW 17 71077767 missense possibly damaging 0.74
R1324:Myom1 UTSW 17 71052719 missense probably damaging 0.98
R2102:Myom1 UTSW 17 71101029 missense probably damaging 1.00
R2158:Myom1 UTSW 17 71064597 missense possibly damaging 0.83
R2336:Myom1 UTSW 17 71023194 missense possibly damaging 0.53
R2351:Myom1 UTSW 17 71034579 missense probably damaging 0.98
R2442:Myom1 UTSW 17 71110735 missense probably damaging 1.00
R2483:Myom1 UTSW 17 71077812 missense probably damaging 1.00
R2892:Myom1 UTSW 17 71034653 missense probably damaging 1.00
R2897:Myom1 UTSW 17 71101220 splice site probably benign
R3440:Myom1 UTSW 17 71045663 intron probably null
R3842:Myom1 UTSW 17 71045624 missense probably damaging 1.00
R4249:Myom1 UTSW 17 71092140 missense probably damaging 1.00
R4329:Myom1 UTSW 17 71036353 missense probably damaging 1.00
R4594:Myom1 UTSW 17 71100074 missense possibly damaging 0.73
R4873:Myom1 UTSW 17 71072119 missense probably damaging 1.00
R4875:Myom1 UTSW 17 71072119 missense probably damaging 1.00
R4876:Myom1 UTSW 17 71077410 missense probably damaging 1.00
R5171:Myom1 UTSW 17 71099972 missense possibly damaging 0.94
R5540:Myom1 UTSW 17 71109787 missense probably damaging 1.00
R5882:Myom1 UTSW 17 71110722 missense probably damaging 1.00
R5978:Myom1 UTSW 17 71117443 missense probably damaging 1.00
R6039:Myom1 UTSW 17 71110751 missense probably damaging 1.00
R6039:Myom1 UTSW 17 71110751 missense probably damaging 1.00
R6155:Myom1 UTSW 17 71108695 critical splice donor site probably null
R6261:Myom1 UTSW 17 71126137 missense probably damaging 1.00
R6284:Myom1 UTSW 17 71022892 nonsense probably null
R6369:Myom1 UTSW 17 71101076 missense probably damaging 1.00
R6545:Myom1 UTSW 17 71082305 missense probably benign 0.00
R6738:Myom1 UTSW 17 71100398 intron probably null
R6933:Myom1 UTSW 17 71052671 missense probably damaging 1.00
X0019:Myom1 UTSW 17 71100071 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TGGACTAACAGACTCCAGGG -3'
(R):5'- ATAGCGTTATCAGGTCAAATCGTG -3'

Sequencing Primer
(F):5'- CTCAGAAAGATGCTTTGCTCG -3'
(R):5'- GGTCAAATCGTGTTGAATGACTGAC -3'
Posted On2018-04-02