Incidental Mutation 'R6315:Atp8b1'
ID510624
Institutional Source Beutler Lab
Gene Symbol Atp8b1
Ensembl Gene ENSMUSG00000039529
Gene NameATPase, class I, type 8B, member 1
SynonymsFIC1, Ic
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6315 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location64528979-64661000 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 64531479 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 1206 (R1206L)
Ref Sequence ENSEMBL: ENSMUSP00000025482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025482]
Predicted Effect probably damaging
Transcript: ENSMUST00000025482
AA Change: R1206L

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025482
Gene: ENSMUSG00000039529
AA Change: R1206L

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 65 144 5.3e-29 PFAM
Pfam:E1-E2_ATPase 146 413 6e-11 PFAM
Pfam:HAD 451 902 2.4e-21 PFAM
Pfam:Cation_ATPase 532 632 1e-12 PFAM
Pfam:PhoLip_ATPase_C 919 1173 7.3e-82 PFAM
low complexity region 1193 1207 N/A INTRINSIC
low complexity region 1221 1232 N/A INTRINSIC
Meta Mutation Damage Score 0.184 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the P-type cation transport ATPase family, which belongs to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. Mutations in this gene may result in progressive familial intrahepatic cholestasis type 1 and in benign recurrent intrahepatic cholestasis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice display abnormal bile salt homeostasis, normal bile secretion, and an impaired ability to handle increased bile salt loading resulting in liver damage and weight loss on a bile salt supplemented diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T C 7: 120,346,092 Y464H probably damaging Het
Ahnak T C 19: 9,006,626 M1758T probably damaging Het
Ak9 A T 10: 41,406,841 D1201V possibly damaging Het
Amdhd2 A C 17: 24,158,356 H203Q probably benign Het
Ano3 A G 2: 110,697,039 M608T probably damaging Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
B4galt5 A T 2: 167,305,809 N215K probably damaging Het
Bpifa1 A G 2: 154,146,076 K180E possibly damaging Het
Cadm1 C T 9: 47,810,119 T269M probably damaging Het
Cadm3 T C 1: 173,344,352 D252G probably benign Het
Ccdc18 A G 5: 108,161,582 R348G probably benign Het
Cers4 G A 8: 4,516,980 C94Y probably benign Het
Cfap58 G A 19: 47,941,277 R59H probably benign Het
Col19a1 C T 1: 24,526,452 G266D unknown Het
Col6a5 G T 9: 105,881,970 F2012L probably damaging Het
Dnah6 T C 6: 73,191,605 Q445R probably benign Het
Dsg3 A G 18: 20,524,586 S238G probably benign Het
E130308A19Rik G A 4: 59,691,132 S322N probably benign Het
Eif5b A G 1: 38,018,033 D57G unknown Het
Fbn2 T C 18: 58,054,953 probably null Het
Fbxo38 A T 18: 62,536,147 C77* probably null Het
Fgb T A 3: 83,045,055 Q169L probably benign Het
Fut9 A T 4: 25,619,774 Y347N probably damaging Het
Gabrg2 T C 11: 41,971,861 K132R probably damaging Het
Gpn3 C T 5: 122,372,575 probably benign Het
Helz2 A G 2: 181,233,202 L1833P probably damaging Het
Hk3 C T 13: 55,011,157 D484N probably benign Het
Icam4 T C 9: 21,029,952 V129A probably damaging Het
Impdh2 T C 9: 108,563,439 S280P possibly damaging Het
Impg1 C A 9: 80,394,074 G267V probably benign Het
Iqgap1 C T 7: 80,799,890 V39M possibly damaging Het
Lyst A G 13: 13,643,504 N1253S probably benign Het
Mgat4b T A 11: 50,231,764 V195E probably damaging Het
Mrgprb8 C T 7: 48,389,235 T218I probably damaging Het
Myrfl T G 10: 116,822,819 E411A possibly damaging Het
Myt1l T C 12: 29,827,798 S483P unknown Het
Neil2 A G 14: 63,183,471 V80A possibly damaging Het
Nfe2l2 G T 2: 75,676,819 D312E probably damaging Het
Nin A T 12: 70,045,615 L640Q probably damaging Het
Nup205 T A 6: 35,236,869 I1732N probably damaging Het
Nupl2 T C 5: 24,167,504 S97P probably damaging Het
Olfr1468-ps1 T C 19: 13,375,405 C148R unknown Het
Olfr180 A C 16: 58,916,246 Y132D probably damaging Het
Plcb1 A T 2: 135,346,341 T785S probably benign Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Ppp1r1b A G 11: 98,355,390 E66G probably damaging Het
Ros1 A T 10: 52,118,210 W1325R probably benign Het
Sec14l5 A C 16: 5,180,277 E500A possibly damaging Het
Sirpb1c A G 3: 15,832,306 V302A possibly damaging Het
Spata19 T C 9: 27,400,837 Y107H possibly damaging Het
Sv2a G A 3: 96,188,186 M298I probably benign Het
Tdrd6 A T 17: 43,626,338 M1273K probably benign Het
Tectb A G 19: 55,191,472 H250R possibly damaging Het
Trip11 T G 12: 101,885,578 E742D possibly damaging Het
Tslp A G 18: 32,817,090 T71A probably benign Het
Usp20 C T 2: 31,017,758 R711C possibly damaging Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Vmn2r8 A T 5: 108,801,891 F363L probably benign Het
Vsnl1 T A 12: 11,332,155 N75I probably damaging Het
Wdr55 A T 18: 36,762,069 D96V probably damaging Het
Wls T A 3: 159,934,371 probably null Het
Zc3h13 A G 14: 75,308,915 D152G probably damaging Het
Zc3h18 A G 8: 122,383,865 E151G probably benign Het
Zfat A G 15: 68,084,462 S1174P probably damaging Het
Zfyve9 T A 4: 108,674,488 T416S probably damaging Het
Other mutations in Atp8b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Atp8b1 APN 18 64564430 missense probably benign 0.23
IGL00907:Atp8b1 APN 18 64561705 missense possibly damaging 0.95
IGL00962:Atp8b1 APN 18 64531444 missense probably damaging 1.00
IGL01433:Atp8b1 APN 18 64573519 missense probably benign 0.00
IGL01525:Atp8b1 APN 18 64539252 nonsense probably null
IGL01645:Atp8b1 APN 18 64546113 missense probably benign 0.06
IGL02008:Atp8b1 APN 18 64538695 splice site probably benign
IGL02227:Atp8b1 APN 18 64562190 missense probably benign
IGL02231:Atp8b1 APN 18 64550384 missense possibly damaging 0.94
IGL02326:Atp8b1 APN 18 64538583 missense probably damaging 0.99
IGL02562:Atp8b1 APN 18 64581986 missense probably benign
IGL02929:Atp8b1 APN 18 64561662 missense possibly damaging 0.63
enchilada UTSW 18 64545989 critical splice donor site probably null
PIT4520001:Atp8b1 UTSW 18 64568180 missense probably benign 0.34
PIT4696001:Atp8b1 UTSW 18 64539270 missense possibly damaging 0.93
R0144:Atp8b1 UTSW 18 64571374 splice site probably benign
R0193:Atp8b1 UTSW 18 64561636 missense probably benign
R0277:Atp8b1 UTSW 18 64568252 missense possibly damaging 0.94
R0308:Atp8b1 UTSW 18 64545244 nonsense probably null
R0323:Atp8b1 UTSW 18 64568252 missense possibly damaging 0.94
R0403:Atp8b1 UTSW 18 64540310 missense probably damaging 1.00
R0601:Atp8b1 UTSW 18 64571653 splice site probably null
R0614:Atp8b1 UTSW 18 64533587 splice site probably benign
R0883:Atp8b1 UTSW 18 64564541 missense probably benign 0.44
R1077:Atp8b1 UTSW 18 64573262 nonsense probably null
R1292:Atp8b1 UTSW 18 64571021 missense probably damaging 0.99
R1494:Atp8b1 UTSW 18 64564526 missense probably damaging 1.00
R1522:Atp8b1 UTSW 18 64550432 missense probably benign 0.00
R1534:Atp8b1 UTSW 18 64545264 missense probably damaging 1.00
R1535:Atp8b1 UTSW 18 64545264 missense probably damaging 1.00
R1536:Atp8b1 UTSW 18 64545264 missense probably damaging 1.00
R1537:Atp8b1 UTSW 18 64545264 missense probably damaging 1.00
R1650:Atp8b1 UTSW 18 64571549 splice site probably benign
R1772:Atp8b1 UTSW 18 64573492 missense possibly damaging 0.88
R2016:Atp8b1 UTSW 18 64540334 missense probably damaging 1.00
R2017:Atp8b1 UTSW 18 64540334 missense probably damaging 1.00
R2043:Atp8b1 UTSW 18 64605200 missense possibly damaging 0.94
R2223:Atp8b1 UTSW 18 64564357 missense possibly damaging 0.88
R3052:Atp8b1 UTSW 18 64553108 missense probably benign 0.04
R3694:Atp8b1 UTSW 18 64533721 missense possibly damaging 0.81
R3738:Atp8b1 UTSW 18 64533729 splice site probably benign
R4211:Atp8b1 UTSW 18 64553047 missense probably damaging 1.00
R4362:Atp8b1 UTSW 18 64564537 missense probably damaging 1.00
R4560:Atp8b1 UTSW 18 64556879 nonsense probably null
R4560:Atp8b1 UTSW 18 64568247 missense probably benign 0.11
R4562:Atp8b1 UTSW 18 64556891 missense probably damaging 1.00
R4615:Atp8b1 UTSW 18 64553099 missense probably null
R4676:Atp8b1 UTSW 18 64538678 missense probably benign 0.01
R4738:Atp8b1 UTSW 18 64545180 missense probably benign 0.31
R4774:Atp8b1 UTSW 18 64533659 missense possibly damaging 0.49
R4808:Atp8b1 UTSW 18 64561711 missense probably benign 0.01
R4868:Atp8b1 UTSW 18 64551866 missense probably damaging 1.00
R5162:Atp8b1 UTSW 18 64561662 missense possibly damaging 0.63
R5289:Atp8b1 UTSW 18 64546087 missense possibly damaging 0.51
R5328:Atp8b1 UTSW 18 64531391 missense probably benign 0.00
R5400:Atp8b1 UTSW 18 64545989 critical splice donor site probably null
R5587:Atp8b1 UTSW 18 64539210 missense probably damaging 1.00
R5623:Atp8b1 UTSW 18 64546094 missense possibly damaging 0.85
R5651:Atp8b1 UTSW 18 64531382 missense probably benign 0.31
R5652:Atp8b1 UTSW 18 64531382 missense probably benign 0.31
R5653:Atp8b1 UTSW 18 64545197 missense probably damaging 1.00
R5667:Atp8b1 UTSW 18 64581923 missense probably damaging 1.00
R5689:Atp8b1 UTSW 18 64564537 missense probably damaging 1.00
R6008:Atp8b1 UTSW 18 64577616 missense probably damaging 1.00
R6759:Atp8b1 UTSW 18 64546090 missense probably benign 0.00
R6850:Atp8b1 UTSW 18 64556852 missense possibly damaging 0.94
R7255:Atp8b1 UTSW 18 64556868 missense probably damaging 1.00
X0025:Atp8b1 UTSW 18 64571405 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGTGACAACTTCAGTTTGTTTGTG -3'
(R):5'- TGCATAAGGGTGTAAAGGCTCTC -3'

Sequencing Primer
(F):5'- AGGTCCTGAGTCGTTCATTAAAG -3'
(R):5'- TGTAAAGGCTCTCCGCGG -3'
Posted On2018-04-02