Incidental Mutation 'R6336:Cntnap5b'
ID510737
Institutional Source Beutler Lab
Gene Symbol Cntnap5b
Ensembl Gene ENSMUSG00000067028
Gene Namecontactin associated protein-like 5B
SynonymsCaspr5-2, C230078M14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R6336 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location99772765-100485942 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 100358669 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 383 (A383V)
Ref Sequence ENSEMBL: ENSMUSP00000139877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086738] [ENSMUST00000188735]
Predicted Effect probably benign
Transcript: ENSMUST00000086738
AA Change: A697V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000083944
Gene: ENSMUSG00000067028
AA Change: A697V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
FA58C 39 174 2.76e-16 SMART
LamG 201 338 2.84e-27 SMART
LamG 387 521 9.22e-27 SMART
EGF 549 583 1.14e0 SMART
Blast:FBG 586 758 3e-66 BLAST
LamG 798 925 2.12e-26 SMART
EGF 946 982 1.51e0 SMART
LamG 1023 1159 2.14e-13 SMART
transmembrane domain 1227 1249 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185484
Predicted Effect probably benign
Transcript: ENSMUST00000188735
AA Change: A383V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000139877
Gene: ENSMUSG00000067028
AA Change: A383V

DomainStartEndE-ValueType
LamG 73 207 5.9e-29 SMART
EGF 235 269 5.6e-3 SMART
Blast:FBG 272 402 2e-42 BLAST
LamG 415 554 2.5e-11 SMART
EGF 575 611 7.1e-3 SMART
LamG 652 788 1.4e-15 SMART
transmembrane domain 856 878 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G T 5: 113,183,483 P955Q possibly damaging Het
Adgrv1 T C 13: 81,385,981 N5827S probably benign Het
Akt3 T C 1: 177,031,712 D431G probably damaging Het
Anapc16 A T 10: 59,988,829 V76D possibly damaging Het
Ankib1 A T 5: 3,700,377 Y755* probably null Het
Ankrd6 A G 4: 32,860,411 S11P probably damaging Het
Card6 T A 15: 5,099,164 K917* probably null Het
Ccdc152 T C 15: 3,301,129 I21M probably damaging Het
Ccdc40 A G 11: 119,231,993 E207G possibly damaging Het
Clca3a2 G T 3: 144,806,478 A499E probably benign Het
Ddo T C 10: 40,633,031 V89A probably damaging Het
Depdc5 T C 5: 32,964,507 probably null Het
Dlgap1 T A 17: 70,815,289 D904E probably damaging Het
Ephb4 T A 5: 137,372,085 L849H probably damaging Het
Fbxl13 A G 5: 21,523,547 probably null Het
Fer1l6 C A 15: 58,559,232 Y245* probably null Het
Foxred2 A G 15: 77,955,764 Y109H probably damaging Het
Gabarapl1 A G 6: 129,537,528 D43G probably benign Het
Gabrb1 A C 5: 72,029,898 E178A possibly damaging Het
Gbp11 A G 5: 105,325,489 Het
Gm31371 A G 8: 19,924,350 K242E unknown Het
Grin3b C A 10: 79,976,461 A845E probably damaging Het
Hoxd4 A G 2: 74,727,361 Y28C probably damaging Het
Igsf10 G A 3: 59,330,339 T807M probably benign Het
Kcnt1 A G 2: 25,888,755 probably null Het
Kdm5a C A 6: 120,398,978 T565K probably damaging Het
Map7d1 A G 4: 126,236,682 S412P probably damaging Het
Mok A G 12: 110,834,124 probably null Het
Mto1 A T 9: 78,473,835 I73F probably damaging Het
Mtss1l G A 8: 110,732,164 D310N probably damaging Het
Ncf2 T C 1: 152,834,070 Y393H probably damaging Het
Olfr1299 A G 2: 111,664,619 H131R possibly damaging Het
Olfr1317 A C 2: 112,142,406 I154L probably benign Het
Olfr1384 G T 11: 49,514,542 K301N probably damaging Het
Olfr272 A T 4: 52,911,459 C112S probably damaging Het
Olfr38 T C 6: 42,762,657 S202P probably damaging Het
Olfr67 T C 7: 103,788,245 T11A possibly damaging Het
Phxr2 T A 10: 99,126,090 probably benign Het
Rnf17 A G 14: 56,421,169 probably null Het
Serpinb9d T C 13: 33,194,694 M41T probably damaging Het
Slc12a5 T A 2: 164,992,464 probably null Het
Slc22a6 G A 19: 8,622,130 R331H probably benign Het
Spg11 G C 2: 122,112,959 probably null Het
Src T A 2: 157,457,155 V24E probably benign Het
Srgap1 A T 10: 121,925,941 Y101N probably benign Het
Vmn2r30 T A 7: 7,334,308 T110S probably benign Het
Vwa3a A G 7: 120,762,423 E119G possibly damaging Het
Whamm T A 7: 81,591,764 D274E probably damaging Het
Other mutations in Cntnap5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Cntnap5b APN 1 100050754 missense probably damaging 1.00
IGL00477:Cntnap5b APN 1 100213743 missense probably damaging 0.97
IGL00505:Cntnap5b APN 1 100379161 missense possibly damaging 0.81
IGL00596:Cntnap5b APN 1 100379161 missense possibly damaging 0.81
IGL00846:Cntnap5b APN 1 100164223 missense probably damaging 1.00
IGL00895:Cntnap5b APN 1 100383585 missense probably damaging 0.98
IGL00948:Cntnap5b APN 1 100141357 missense probably benign 0.00
IGL01073:Cntnap5b APN 1 100076030 missense probably benign 0.08
IGL01523:Cntnap5b APN 1 100431779 missense probably benign 0.02
IGL01779:Cntnap5b APN 1 99967339 missense probably damaging 1.00
IGL02253:Cntnap5b APN 1 100164211 missense possibly damaging 0.75
IGL02628:Cntnap5b APN 1 100072069 missense probably damaging 0.97
R0166:Cntnap5b UTSW 1 100274361 missense probably benign 0.41
R0211:Cntnap5b UTSW 1 100478374 missense possibly damaging 0.82
R0281:Cntnap5b UTSW 1 100072153 missense probably benign 0.22
R0363:Cntnap5b UTSW 1 100274468 missense probably benign 0.01
R0514:Cntnap5b UTSW 1 99772786 missense probably benign
R0645:Cntnap5b UTSW 1 100072042 splice site probably benign
R0848:Cntnap5b UTSW 1 100255163 missense probably benign 0.22
R1006:Cntnap5b UTSW 1 100383617 missense probably benign 0.00
R1349:Cntnap5b UTSW 1 100164088 missense probably benign 0.09
R1372:Cntnap5b UTSW 1 100164088 missense probably benign 0.09
R1474:Cntnap5b UTSW 1 100072089 missense probably benign 0.25
R1681:Cntnap5b UTSW 1 100076107 missense probably damaging 0.98
R1727:Cntnap5b UTSW 1 100213744 missense possibly damaging 0.91
R1760:Cntnap5b UTSW 1 99772810 missense probably benign 0.05
R1777:Cntnap5b UTSW 1 100370078 missense probably benign 0.10
R1939:Cntnap5b UTSW 1 99967348 missense probably benign
R1988:Cntnap5b UTSW 1 100072140 missense possibly damaging 0.92
R2069:Cntnap5b UTSW 1 100358725 missense probably benign 0.04
R2113:Cntnap5b UTSW 1 100274415 missense probably benign
R2148:Cntnap5b UTSW 1 100383474 missense probably benign 0.01
R2158:Cntnap5b UTSW 1 100390572 missense probably damaging 1.00
R2223:Cntnap5b UTSW 1 100213687 missense probably damaging 1.00
R2350:Cntnap5b UTSW 1 100379126 missense probably damaging 1.00
R3840:Cntnap5b UTSW 1 100383477 missense possibly damaging 0.50
R4329:Cntnap5b UTSW 1 100072163 missense probably damaging 0.99
R4609:Cntnap5b UTSW 1 99772847 critical splice donor site probably null
R4799:Cntnap5b UTSW 1 100358725 missense probably benign 0.04
R5129:Cntnap5b UTSW 1 100379090 missense probably damaging 1.00
R5323:Cntnap5b UTSW 1 100383550 nonsense probably null
R5434:Cntnap5b UTSW 1 100072201 missense probably benign 0.02
R5579:Cntnap5b UTSW 1 100383395 nonsense probably null
R5579:Cntnap5b UTSW 1 100383399 missense probably benign 0.27
R5630:Cntnap5b UTSW 1 100072069 missense probably damaging 0.99
R5644:Cntnap5b UTSW 1 100383601 missense probably benign 0.00
R5761:Cntnap5b UTSW 1 100446894 missense probably damaging 1.00
R6042:Cntnap5b UTSW 1 100390592 missense probably benign
R6147:Cntnap5b UTSW 1 100050781 missense probably damaging 1.00
R6190:Cntnap5b UTSW 1 100379075 missense possibly damaging 0.80
R6248:Cntnap5b UTSW 1 100072102 missense probably benign 0.30
R6286:Cntnap5b UTSW 1 100255073 missense possibly damaging 0.82
R6306:Cntnap5b UTSW 1 100164146 missense probably damaging 1.00
R6360:Cntnap5b UTSW 1 100431736 nonsense probably null
R6722:Cntnap5b UTSW 1 100478486 missense probably damaging 0.98
R6750:Cntnap5b UTSW 1 100274499 missense probably damaging 1.00
R6806:Cntnap5b UTSW 1 99940649 missense probably damaging 1.00
R6933:Cntnap5b UTSW 1 100383450 missense probably benign 0.01
R6957:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R6958:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R6959:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R6961:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R6962:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R7088:Cntnap5b UTSW 1 100160077 missense not run
X0020:Cntnap5b UTSW 1 100431848 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATCAAGTTGAGTGTCTGTCTTTGAC -3'
(R):5'- TTACTAACTGGTGGTCAAGGCAC -3'

Sequencing Primer
(F):5'- ACTCTTAATGGTTTCATTTATCAGCC -3'
(R):5'- CTGGTGGTCAAGGCACAGAAC -3'
Posted On2018-04-02