Incidental Mutation 'R6336:Hoxd4'
ID510740
Institutional Source Beutler Lab
Gene Symbol Hoxd4
Ensembl Gene ENSMUSG00000101174
Gene Namehomeobox D4
SynonymsHox-4.2, Hox-5.1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.416) question?
Stock #R6336 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location74711929-74729123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74727361 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 28 (Y28C)
Ref Sequence ENSEMBL: ENSMUSP00000051355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047904] [ENSMUST00000053932] [ENSMUST00000111980] [ENSMUST00000111983]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047904
AA Change: Y28C

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000047949
Gene: ENSMUSG00000115956
AA Change: Y28C

DomainStartEndE-ValueType
low complexity region 63 70 N/A INTRINSIC
low complexity region 91 110 N/A INTRINSIC
low complexity region 112 123 N/A INTRINSIC
HOX 152 214 2.46e-26 SMART
low complexity region 220 229 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000053932
AA Change: Y28C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051355
Gene: ENSMUSG00000100642
AA Change: Y28C

DomainStartEndE-ValueType
low complexity region 93 135 N/A INTRINSIC
low complexity region 141 159 N/A INTRINSIC
HOX 195 257 5.83e-28 SMART
Pfam:DUF4074 370 431 1.4e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083566
Predicted Effect possibly damaging
Transcript: ENSMUST00000111980
AA Change: Y28C

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107611
Gene: ENSMUSG00000101174
AA Change: Y28C

DomainStartEndE-ValueType
low complexity region 63 70 N/A INTRINSIC
low complexity region 91 110 N/A INTRINSIC
low complexity region 112 123 N/A INTRINSIC
HOX 152 214 2.46e-26 SMART
low complexity region 220 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111983
SMART Domains Protein: ENSMUSP00000107614
Gene: ENSMUSG00000079277

DomainStartEndE-ValueType
low complexity region 93 135 N/A INTRINSIC
low complexity region 141 159 N/A INTRINSIC
HOX 195 257 5.83e-28 SMART
Pfam:DUF4074 369 431 8.9e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144040
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located at 2q31-2q37 chromosome regions. Deletions that removed the entire HOXD gene cluster or 5' end of this cluster have been associated with severe limb and genital abnormalities. The protein encoded by this gene may play a role in determining positional values in developing limb buds. Alternatively spliced variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Both homozygotes and heterozygotes for a targeted null mutation exhibit homeotic transformations of the second cervical vertebrae and malformed neural arches of C1 to C3 and of the basioccipital bone. Mutants show variable penetrance and expressivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G T 5: 113,183,483 P955Q possibly damaging Het
Adgrv1 T C 13: 81,385,981 N5827S probably benign Het
Akt3 T C 1: 177,031,712 D431G probably damaging Het
Anapc16 A T 10: 59,988,829 V76D possibly damaging Het
Ankib1 A T 5: 3,700,377 Y755* probably null Het
Ankrd6 A G 4: 32,860,411 S11P probably damaging Het
Card6 T A 15: 5,099,164 K917* probably null Het
Ccdc152 T C 15: 3,301,129 I21M probably damaging Het
Ccdc40 A G 11: 119,231,993 E207G possibly damaging Het
Clca3a2 G T 3: 144,806,478 A499E probably benign Het
Cntnap5b C T 1: 100,358,669 A383V probably benign Het
Ddo T C 10: 40,633,031 V89A probably damaging Het
Depdc5 T C 5: 32,964,507 probably null Het
Dlgap1 T A 17: 70,815,289 D904E probably damaging Het
Ephb4 T A 5: 137,372,085 L849H probably damaging Het
Fbxl13 A G 5: 21,523,547 probably null Het
Fer1l6 C A 15: 58,559,232 Y245* probably null Het
Foxred2 A G 15: 77,955,764 Y109H probably damaging Het
Gabarapl1 A G 6: 129,537,528 D43G probably benign Het
Gabrb1 A C 5: 72,029,898 E178A possibly damaging Het
Gbp11 A G 5: 105,325,489 Het
Gm31371 A G 8: 19,924,350 K242E unknown Het
Grin3b C A 10: 79,976,461 A845E probably damaging Het
Igsf10 G A 3: 59,330,339 T807M probably benign Het
Kcnt1 A G 2: 25,888,755 probably null Het
Kdm5a C A 6: 120,398,978 T565K probably damaging Het
Map7d1 A G 4: 126,236,682 S412P probably damaging Het
Mok A G 12: 110,834,124 probably null Het
Mto1 A T 9: 78,473,835 I73F probably damaging Het
Mtss1l G A 8: 110,732,164 D310N probably damaging Het
Ncf2 T C 1: 152,834,070 Y393H probably damaging Het
Olfr1299 A G 2: 111,664,619 H131R possibly damaging Het
Olfr1317 A C 2: 112,142,406 I154L probably benign Het
Olfr1384 G T 11: 49,514,542 K301N probably damaging Het
Olfr272 A T 4: 52,911,459 C112S probably damaging Het
Olfr38 T C 6: 42,762,657 S202P probably damaging Het
Olfr67 T C 7: 103,788,245 T11A possibly damaging Het
Phxr2 T A 10: 99,126,090 probably benign Het
Rnf17 A G 14: 56,421,169 probably null Het
Serpinb9d T C 13: 33,194,694 M41T probably damaging Het
Slc12a5 T A 2: 164,992,464 probably null Het
Slc22a6 G A 19: 8,622,130 R331H probably benign Het
Spg11 G C 2: 122,112,959 probably null Het
Src T A 2: 157,457,155 V24E probably benign Het
Srgap1 A T 10: 121,925,941 Y101N probably benign Het
Vmn2r30 T A 7: 7,334,308 T110S probably benign Het
Vwa3a A G 7: 120,762,423 E119G possibly damaging Het
Whamm T A 7: 81,591,764 D274E probably damaging Het
Other mutations in Hoxd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02034:Hoxd4 APN 2 74728406 missense probably damaging 0.98
IGL03403:Hoxd4 APN 2 74728337 missense possibly damaging 0.93
R0153:Hoxd4 UTSW 2 74727457 missense probably damaging 0.96
R3424:Hoxd4 UTSW 2 74727313 missense probably damaging 1.00
R5447:Hoxd4 UTSW 2 74727343 missense probably damaging 1.00
R5715:Hoxd4 UTSW 2 74727364 missense probably damaging 1.00
R6197:Hoxd4 UTSW 2 74728463 missense possibly damaging 0.85
R6264:Hoxd4 UTSW 2 74727385 missense possibly damaging 0.53
R6310:Hoxd4 UTSW 2 74728390 missense possibly damaging 0.84
R6921:Hoxd4 UTSW 2 74728492 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TTCAGTTGACAGCAAGTAGGAG -3'
(R):5'- CATCCAAGGGTAGACCACAG -3'

Sequencing Primer
(F):5'- CAGCAAGTAGGAGGGCCC -3'
(R):5'- ACCGTAATGACTTCCCGGG -3'
Posted On2018-04-02