Incidental Mutation 'R6336:Olfr1299'
ID510741
Institutional Source Beutler Lab
Gene Symbol Olfr1299
Ensembl Gene ENSMUSG00000109219
Gene Nameolfactory receptor 1299
SynonymsGA_x6K02T2Q125-72715642-72716580, MOR248-8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R6336 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location111661419-111665814 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111664619 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 131 (H131R)
Ref Sequence ENSEMBL: ENSMUSP00000149299 (fasta)
Predicted Effect possibly damaging
Transcript: ENSMUST00000207228
AA Change: H131R

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000208175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208983
Predicted Effect possibly damaging
Transcript: ENSMUST00000213511
AA Change: H131R

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.254 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G T 5: 113,183,483 P955Q possibly damaging Het
Adgrv1 T C 13: 81,385,981 N5827S probably benign Het
Akt3 T C 1: 177,031,712 D431G probably damaging Het
Anapc16 A T 10: 59,988,829 V76D possibly damaging Het
Ankib1 A T 5: 3,700,377 Y755* probably null Het
Ankrd6 A G 4: 32,860,411 S11P probably damaging Het
Card6 T A 15: 5,099,164 K917* probably null Het
Ccdc152 T C 15: 3,301,129 I21M probably damaging Het
Ccdc40 A G 11: 119,231,993 E207G possibly damaging Het
Clca3a2 G T 3: 144,806,478 A499E probably benign Het
Cntnap5b C T 1: 100,358,669 A383V probably benign Het
Ddo T C 10: 40,633,031 V89A probably damaging Het
Depdc5 T C 5: 32,964,507 probably null Het
Dlgap1 T A 17: 70,815,289 D904E probably damaging Het
Ephb4 T A 5: 137,372,085 L849H probably damaging Het
Fbxl13 A G 5: 21,523,547 probably null Het
Fer1l6 C A 15: 58,559,232 Y245* probably null Het
Foxred2 A G 15: 77,955,764 Y109H probably damaging Het
Gabarapl1 A G 6: 129,537,528 D43G probably benign Het
Gabrb1 A C 5: 72,029,898 E178A possibly damaging Het
Gbp11 A G 5: 105,325,489 Het
Gm31371 A G 8: 19,924,350 K242E unknown Het
Grin3b C A 10: 79,976,461 A845E probably damaging Het
Hoxd4 A G 2: 74,727,361 Y28C probably damaging Het
Igsf10 G A 3: 59,330,339 T807M probably benign Het
Kcnt1 A G 2: 25,888,755 probably null Het
Kdm5a C A 6: 120,398,978 T565K probably damaging Het
Map7d1 A G 4: 126,236,682 S412P probably damaging Het
Mok A G 12: 110,834,124 probably null Het
Mto1 A T 9: 78,473,835 I73F probably damaging Het
Mtss1l G A 8: 110,732,164 D310N probably damaging Het
Ncf2 T C 1: 152,834,070 Y393H probably damaging Het
Olfr1317 A C 2: 112,142,406 I154L probably benign Het
Olfr1384 G T 11: 49,514,542 K301N probably damaging Het
Olfr272 A T 4: 52,911,459 C112S probably damaging Het
Olfr38 T C 6: 42,762,657 S202P probably damaging Het
Olfr67 T C 7: 103,788,245 T11A possibly damaging Het
Phxr2 T A 10: 99,126,090 probably benign Het
Rnf17 A G 14: 56,421,169 probably null Het
Serpinb9d T C 13: 33,194,694 M41T probably damaging Het
Slc12a5 T A 2: 164,992,464 probably null Het
Slc22a6 G A 19: 8,622,130 R331H probably benign Het
Spg11 G C 2: 122,112,959 probably null Het
Src T A 2: 157,457,155 V24E probably benign Het
Srgap1 A T 10: 121,925,941 Y101N probably benign Het
Vmn2r30 T A 7: 7,334,308 T110S probably benign Het
Vwa3a A G 7: 120,762,423 E119G possibly damaging Het
Whamm T A 7: 81,591,764 D274E probably damaging Het
Other mutations in Olfr1299
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Olfr1299 APN 2 111665144 missense probably benign 0.00
IGL02090:Olfr1299 APN 2 111664988 missense probably damaging 0.99
IGL02213:Olfr1299 APN 2 111664675 missense probably benign 0.05
R0603:Olfr1299 UTSW 2 111664880 missense probably damaging 1.00
R1598:Olfr1299 UTSW 2 111664754 missense probably damaging 1.00
R1802:Olfr1299 UTSW 2 111664754 missense probably damaging 1.00
R1803:Olfr1299 UTSW 2 111664754 missense probably damaging 1.00
R1885:Olfr1299 UTSW 2 111664754 missense probably damaging 1.00
R1887:Olfr1299 UTSW 2 111664754 missense probably damaging 1.00
R1962:Olfr1299 UTSW 2 111664889 missense probably damaging 1.00
R2024:Olfr1299 UTSW 2 111664823 missense possibly damaging 0.53
R2438:Olfr1299 UTSW 2 111664751 missense probably damaging 1.00
R5132:Olfr1299 UTSW 2 111664999 missense probably damaging 1.00
R5938:Olfr1299 UTSW 2 111664363 missense probably benign
R6115:Olfr1299 UTSW 2 111664642 nonsense probably null
R6418:Olfr1299 UTSW 2 111664472 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTTCTTGTTGGCCAACCTG -3'
(R):5'- TCATGGGAATCTGTGCAGG -3'

Sequencing Primer
(F):5'- AACCTGTCCTTTGTTGATATATGGC -3'
(R):5'- AATCTGTGCAGGCTAGTTTGATTAC -3'
Posted On2018-04-02