Incidental Mutation 'R6336:Src'
ID510743
Institutional Source Beutler Lab
Gene Symbol Src
Ensembl Gene ENSMUSG00000027646
Gene NameRous sarcoma oncogene
Synonymspp60c-src
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6336 (G1)
Quality Score206.009
Status Validated
Chromosome2
Chromosomal Location157418444-157471862 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 157457155 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 24 (V24E)
Ref Sequence ENSEMBL: ENSMUSP00000105155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029175] [ENSMUST00000092576] [ENSMUST00000109529] [ENSMUST00000109531] [ENSMUST00000109533]
Predicted Effect probably benign
Transcript: ENSMUST00000029175
AA Change: V24E

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000029175
Gene: ENSMUSG00000027646
AA Change: V24E

DomainStartEndE-ValueType
SH3 86 143 2.48e-21 SMART
SH2 148 238 6.56e-37 SMART
TyrKc 269 518 2.97e-131 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092576
AA Change: V24E

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000090237
Gene: ENSMUSG00000027646
AA Change: V24E

DomainStartEndE-ValueType
SH3 86 149 1.2e-19 SMART
SH2 154 244 6.56e-37 SMART
TyrKc 275 524 2.97e-131 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109529
AA Change: V24E

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000105155
Gene: ENSMUSG00000027646
AA Change: V24E

DomainStartEndE-ValueType
SH3 86 149 1.2e-19 SMART
SH2 154 244 6.56e-37 SMART
TyrKc 275 524 2.97e-131 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109531
AA Change: V24E

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000105157
Gene: ENSMUSG00000027646
AA Change: V24E

DomainStartEndE-ValueType
SH3 86 143 2.48e-21 SMART
SH2 148 238 6.56e-37 SMART
TyrKc 269 518 2.97e-131 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109533
AA Change: V24E

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000105159
Gene: ENSMUSG00000027646
AA Change: V24E

DomainStartEndE-ValueType
SH3 86 143 2.48e-21 SMART
SH2 148 238 6.56e-37 SMART
TyrKc 269 518 2.97e-131 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145715
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is highly similar to the v-src gene of Rous sarcoma virus. This proto-oncogene may play a role in the regulation of embryonic development and cell growth. The protein encoded by this gene is a tyrosine-protein kinase whose activity can be inhibited by phosphorylation by c-SRC kinase. Mutations in this gene could be involved in the malignant progression of colon cancer. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit growth retardation, failure of tooth eruption, osteopetrosis with lack of secondary bone resorption, and lethality at 3-4 weeks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G T 5: 113,183,483 P955Q possibly damaging Het
Adgrv1 T C 13: 81,385,981 N5827S probably benign Het
Akt3 T C 1: 177,031,712 D431G probably damaging Het
Anapc16 A T 10: 59,988,829 V76D possibly damaging Het
Ankib1 A T 5: 3,700,377 Y755* probably null Het
Ankrd6 A G 4: 32,860,411 S11P probably damaging Het
Card6 T A 15: 5,099,164 K917* probably null Het
Ccdc152 T C 15: 3,301,129 I21M probably damaging Het
Ccdc40 A G 11: 119,231,993 E207G possibly damaging Het
Clca3a2 G T 3: 144,806,478 A499E probably benign Het
Cntnap5b C T 1: 100,358,669 A383V probably benign Het
Ddo T C 10: 40,633,031 V89A probably damaging Het
Depdc5 T C 5: 32,964,507 probably null Het
Dlgap1 T A 17: 70,815,289 D904E probably damaging Het
Ephb4 T A 5: 137,372,085 L849H probably damaging Het
Fbxl13 A G 5: 21,523,547 probably null Het
Fer1l6 C A 15: 58,559,232 Y245* probably null Het
Foxred2 A G 15: 77,955,764 Y109H probably damaging Het
Gabarapl1 A G 6: 129,537,528 D43G probably benign Het
Gabrb1 A C 5: 72,029,898 E178A possibly damaging Het
Gbp11 A G 5: 105,325,489 Het
Gm31371 A G 8: 19,924,350 K242E unknown Het
Grin3b C A 10: 79,976,461 A845E probably damaging Het
Hoxd4 A G 2: 74,727,361 Y28C probably damaging Het
Igsf10 G A 3: 59,330,339 T807M probably benign Het
Kcnt1 A G 2: 25,888,755 probably null Het
Kdm5a C A 6: 120,398,978 T565K probably damaging Het
Map7d1 A G 4: 126,236,682 S412P probably damaging Het
Mok A G 12: 110,834,124 probably null Het
Mto1 A T 9: 78,473,835 I73F probably damaging Het
Mtss1l G A 8: 110,732,164 D310N probably damaging Het
Ncf2 T C 1: 152,834,070 Y393H probably damaging Het
Olfr1299 A G 2: 111,664,619 H131R possibly damaging Het
Olfr1317 A C 2: 112,142,406 I154L probably benign Het
Olfr1384 G T 11: 49,514,542 K301N probably damaging Het
Olfr272 A T 4: 52,911,459 C112S probably damaging Het
Olfr38 T C 6: 42,762,657 S202P probably damaging Het
Olfr67 T C 7: 103,788,245 T11A possibly damaging Het
Phxr2 T A 10: 99,126,090 probably benign Het
Rnf17 A G 14: 56,421,169 probably null Het
Serpinb9d T C 13: 33,194,694 M41T probably damaging Het
Slc12a5 T A 2: 164,992,464 probably null Het
Slc22a6 G A 19: 8,622,130 R331H probably benign Het
Spg11 G C 2: 122,112,959 probably null Het
Srgap1 A T 10: 121,925,941 Y101N probably benign Het
Vmn2r30 T A 7: 7,334,308 T110S probably benign Het
Vwa3a A G 7: 120,762,423 E119G possibly damaging Het
Whamm T A 7: 81,591,764 D274E probably damaging Het
Other mutations in Src
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Src APN 2 157469503 missense probably damaging 1.00
IGL01320:Src APN 2 157469503 missense probably damaging 1.00
IGL01323:Src APN 2 157469503 missense probably damaging 1.00
IGL01452:Src APN 2 157462983 missense probably damaging 1.00
IGL02618:Src APN 2 157464778 nonsense probably null
R0605:Src UTSW 2 157469921 missense probably damaging 1.00
R1457:Src UTSW 2 157469212 missense probably damaging 1.00
R1471:Src UTSW 2 157457187 nonsense probably null
R1694:Src UTSW 2 157469755 missense possibly damaging 0.95
R2040:Src UTSW 2 157457110 missense probably benign 0.02
R2209:Src UTSW 2 157462790 missense probably benign 0.16
R4112:Src UTSW 2 157463026 missense probably damaging 1.00
R4414:Src UTSW 2 157464653 missense probably damaging 1.00
R4581:Src UTSW 2 157463038 missense probably damaging 0.98
R4661:Src UTSW 2 157469932 missense probably damaging 1.00
R4781:Src UTSW 2 157467485 missense possibly damaging 0.71
R5504:Src UTSW 2 157464721 missense probably damaging 1.00
R5913:Src UTSW 2 157466030 critical splice donor site probably null
R6166:Src UTSW 2 157468522 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGTAATGAGACGAGTCCTCCC -3'
(R):5'- ATTCGCAGCCTCGGGAAAAC -3'

Sequencing Primer
(F):5'- AGGGTGGCTAGTCCCCTTCTTAG -3'
(R):5'- GGGAAAACCGAGTCCCCAG -3'
Posted On2018-04-02