Incidental Mutation 'R6336:Ankrd6'
ID510747
Institutional Source Beutler Lab
Gene Symbol Ankrd6
Ensembl Gene ENSMUSG00000040183
Gene Nameankyrin repeat domain 6
Synonymsdiversin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6336 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location32804035-32950841 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32860411 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 11 (S11P)
Ref Sequence ENSEMBL: ENSMUSP00000103801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035719] [ENSMUST00000084748] [ENSMUST00000084749] [ENSMUST00000084750] [ENSMUST00000108166]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035719
AA Change: S11P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000041300
Gene: ENSMUSG00000040183
AA Change: S11P

DomainStartEndE-ValueType
ANK 9 38 2.55e2 SMART
ANK 41 70 2.08e-7 SMART
ANK 74 103 3.49e0 SMART
ANK 107 136 5.24e-4 SMART
ANK 140 169 3.74e0 SMART
ANK 173 202 6.12e-5 SMART
ANK 206 235 5.32e-5 SMART
ANK 239 268 6.24e2 SMART
low complexity region 365 377 N/A INTRINSIC
coiled coil region 417 445 N/A INTRINSIC
low complexity region 536 556 N/A INTRINSIC
low complexity region 625 643 N/A INTRINSIC
coiled coil region 672 712 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000084748
AA Change: S11P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000081800
Gene: ENSMUSG00000040183
AA Change: S11P

DomainStartEndE-ValueType
ANK 9 38 2.55e2 SMART
ANK 41 70 2.08e-7 SMART
ANK 74 103 3.49e0 SMART
ANK 107 136 5.24e-4 SMART
ANK 140 169 3.74e0 SMART
ANK 173 202 6.12e-5 SMART
ANK 206 235 5.32e-5 SMART
ANK 239 269 2.11e2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 382 410 N/A INTRINSIC
low complexity region 501 521 N/A INTRINSIC
low complexity region 590 608 N/A INTRINSIC
coiled coil region 637 677 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000084749
AA Change: S11P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000081801
Gene: ENSMUSG00000040183
AA Change: S11P

DomainStartEndE-ValueType
ANK 9 38 2.55e2 SMART
ANK 41 70 2.08e-7 SMART
ANK 74 103 3.49e0 SMART
ANK 107 136 5.24e-4 SMART
ANK 140 169 3.74e0 SMART
ANK 173 202 6.12e-5 SMART
ANK 206 235 5.32e-5 SMART
ANK 239 268 6.24e2 SMART
low complexity region 365 377 N/A INTRINSIC
coiled coil region 417 445 N/A INTRINSIC
low complexity region 536 556 N/A INTRINSIC
low complexity region 625 643 N/A INTRINSIC
coiled coil region 672 712 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000084750
AA Change: S11P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000081802
Gene: ENSMUSG00000040183
AA Change: S11P

DomainStartEndE-ValueType
ANK 9 38 2.55e2 SMART
ANK 41 70 2.08e-7 SMART
ANK 74 103 3.49e0 SMART
ANK 107 136 5.24e-4 SMART
ANK 140 169 3.74e0 SMART
ANK 173 202 6.12e-5 SMART
ANK 206 235 5.32e-5 SMART
ANK 239 268 6.24e2 SMART
low complexity region 365 377 N/A INTRINSIC
coiled coil region 417 445 N/A INTRINSIC
low complexity region 536 556 N/A INTRINSIC
low complexity region 625 643 N/A INTRINSIC
coiled coil region 672 712 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108166
AA Change: S11P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103801
Gene: ENSMUSG00000040183
AA Change: S11P

DomainStartEndE-ValueType
ANK 9 38 2.55e2 SMART
ANK 41 70 2.08e-7 SMART
ANK 74 103 3.49e0 SMART
ANK 107 136 3.74e0 SMART
ANK 140 169 6.12e-5 SMART
ANK 173 202 5.32e-5 SMART
low complexity region 207 227 N/A INTRINSIC
low complexity region 306 318 N/A INTRINSIC
coiled coil region 358 386 N/A INTRINSIC
low complexity region 468 491 N/A INTRINSIC
low complexity region 561 579 N/A INTRINSIC
coiled coil region 608 648 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149650
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: This gene encodes a protein which is thought to be involved in the Wnt signaling pathway and embryonic axis formation. Similar genes have been found in human, rhesus macaque, and zebrafish. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display sporadic disruption of utricle hair cell polarity but normal cochlear and vestibular hair cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G T 5: 113,183,483 P955Q possibly damaging Het
Adgrv1 T C 13: 81,385,981 N5827S probably benign Het
Akt3 T C 1: 177,031,712 D431G probably damaging Het
Anapc16 A T 10: 59,988,829 V76D possibly damaging Het
Ankib1 A T 5: 3,700,377 Y755* probably null Het
Card6 T A 15: 5,099,164 K917* probably null Het
Ccdc152 T C 15: 3,301,129 I21M probably damaging Het
Ccdc40 A G 11: 119,231,993 E207G possibly damaging Het
Clca3a2 G T 3: 144,806,478 A499E probably benign Het
Cntnap5b C T 1: 100,358,669 A383V probably benign Het
Ddo T C 10: 40,633,031 V89A probably damaging Het
Depdc5 T C 5: 32,964,507 probably null Het
Dlgap1 T A 17: 70,815,289 D904E probably damaging Het
Ephb4 T A 5: 137,372,085 L849H probably damaging Het
Fbxl13 A G 5: 21,523,547 probably null Het
Fer1l6 C A 15: 58,559,232 Y245* probably null Het
Foxred2 A G 15: 77,955,764 Y109H probably damaging Het
Gabarapl1 A G 6: 129,537,528 D43G probably benign Het
Gabrb1 A C 5: 72,029,898 E178A possibly damaging Het
Gbp11 A G 5: 105,325,489 Het
Gm31371 A G 8: 19,924,350 K242E unknown Het
Grin3b C A 10: 79,976,461 A845E probably damaging Het
Hoxd4 A G 2: 74,727,361 Y28C probably damaging Het
Igsf10 G A 3: 59,330,339 T807M probably benign Het
Kcnt1 A G 2: 25,888,755 probably null Het
Kdm5a C A 6: 120,398,978 T565K probably damaging Het
Map7d1 A G 4: 126,236,682 S412P probably damaging Het
Mok A G 12: 110,834,124 probably null Het
Mto1 A T 9: 78,473,835 I73F probably damaging Het
Mtss1l G A 8: 110,732,164 D310N probably damaging Het
Ncf2 T C 1: 152,834,070 Y393H probably damaging Het
Olfr1299 A G 2: 111,664,619 H131R possibly damaging Het
Olfr1317 A C 2: 112,142,406 I154L probably benign Het
Olfr1384 G T 11: 49,514,542 K301N probably damaging Het
Olfr272 A T 4: 52,911,459 C112S probably damaging Het
Olfr38 T C 6: 42,762,657 S202P probably damaging Het
Olfr67 T C 7: 103,788,245 T11A possibly damaging Het
Phxr2 T A 10: 99,126,090 probably benign Het
Rnf17 A G 14: 56,421,169 probably null Het
Serpinb9d T C 13: 33,194,694 M41T probably damaging Het
Slc12a5 T A 2: 164,992,464 probably null Het
Slc22a6 G A 19: 8,622,130 R331H probably benign Het
Spg11 G C 2: 122,112,959 probably null Het
Src T A 2: 157,457,155 V24E probably benign Het
Srgap1 A T 10: 121,925,941 Y101N probably benign Het
Vmn2r30 T A 7: 7,334,308 T110S probably benign Het
Vwa3a A G 7: 120,762,423 E119G possibly damaging Het
Whamm T A 7: 81,591,764 D274E probably damaging Het
Other mutations in Ankrd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02489:Ankrd6 APN 4 32810298 missense probably damaging 1.00
IGL03247:Ankrd6 APN 4 32860441 start codon destroyed possibly damaging 0.76
IGL03382:Ankrd6 APN 4 32808771 missense probably damaging 1.00
R0360:Ankrd6 UTSW 4 32836424 missense probably damaging 1.00
R0711:Ankrd6 UTSW 4 32815326 missense probably damaging 1.00
R1074:Ankrd6 UTSW 4 32822232 missense probably damaging 1.00
R1075:Ankrd6 UTSW 4 32822232 missense probably damaging 1.00
R1498:Ankrd6 UTSW 4 32810289 missense probably benign 0.17
R1719:Ankrd6 UTSW 4 32828774 missense probably damaging 1.00
R1823:Ankrd6 UTSW 4 32824427 missense probably damaging 1.00
R2889:Ankrd6 UTSW 4 32818704 missense probably damaging 0.99
R2897:Ankrd6 UTSW 4 32860438 missense probably damaging 0.98
R3815:Ankrd6 UTSW 4 32806206 missense probably benign 0.39
R3836:Ankrd6 UTSW 4 32817531 missense probably damaging 1.00
R4127:Ankrd6 UTSW 4 32822241 missense probably damaging 1.00
R4994:Ankrd6 UTSW 4 32860387 missense probably damaging 0.99
R5250:Ankrd6 UTSW 4 32860335 missense probably damaging 1.00
R5291:Ankrd6 UTSW 4 32823446 missense probably damaging 1.00
R5335:Ankrd6 UTSW 4 32818651 missense probably damaging 1.00
R5948:Ankrd6 UTSW 4 32817075 missense possibly damaging 0.91
R6345:Ankrd6 UTSW 4 32810266 missense probably damaging 1.00
R6349:Ankrd6 UTSW 4 32822231 missense probably damaging 1.00
R6516:Ankrd6 UTSW 4 32836427 missense probably damaging 1.00
R6902:Ankrd6 UTSW 4 32806419 missense probably damaging 1.00
R6902:Ankrd6 UTSW 4 32806420 missense probably damaging 1.00
R6999:Ankrd6 UTSW 4 32823459 missense not run
R7044:Ankrd6 UTSW 4 32815260 missense possibly damaging 0.93
X0064:Ankrd6 UTSW 4 32806435 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCCCTTTACCAAAAGCCAGTTC -3'
(R):5'- TCCTCTTGTACTGAGTGGCG -3'

Sequencing Primer
(F):5'- GCCAGTTCTTTTAAAACTATGAACC -3'
(R):5'- TGACCCCCTAGGACCTGAAGATG -3'
Posted On2018-04-02