Incidental Mutation 'R6336:Gabrb1'
ID510752
Institutional Source Beutler Lab
Gene Symbol Gabrb1
Ensembl Gene ENSMUSG00000029212
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit beta 1
SynonymsGabrb-1, B230208N19Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R6336 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location71658113-72149037 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 72029898 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 178 (E178A)
Ref Sequence ENSEMBL: ENSMUSP00000031122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031122] [ENSMUST00000199967]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031122
AA Change: E178A

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000031122
Gene: ENSMUSG00000029212
AA Change: E178A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Neur_chan_LBD 37 243 7.1e-52 PFAM
Pfam:Neur_chan_memb 250 469 2.4e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118973
Predicted Effect probably benign
Transcript: ENSMUST00000199967
AA Change: E145A

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000143682
Gene: ENSMUSG00000029212
AA Change: E145A

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 4 210 4.8e-51 PFAM
Meta Mutation Damage Score 0.306 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gamma-aminobutyric acid (GABA) A receptor is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. This gene encodes GABA A receptor, beta 1 subunit. It is mapped to chromosome 4p12 in a cluster comprised of genes encoding alpha 4, alpha 2 and gamma 1 subunits of the GABA A receptor. Alteration of this gene is implicated in the pathogenetics of schizophrenia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for an ENU or spontaneous mutation exhibit alcohol preference with increased tonic inhibition, female infertility and hypothalamic pituitary axis dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G T 5: 113,183,483 P955Q possibly damaging Het
Adgrv1 T C 13: 81,385,981 N5827S probably benign Het
Akt3 T C 1: 177,031,712 D431G probably damaging Het
Anapc16 A T 10: 59,988,829 V76D possibly damaging Het
Ankib1 A T 5: 3,700,377 Y755* probably null Het
Ankrd6 A G 4: 32,860,411 S11P probably damaging Het
Card6 T A 15: 5,099,164 K917* probably null Het
Ccdc152 T C 15: 3,301,129 I21M probably damaging Het
Ccdc40 A G 11: 119,231,993 E207G possibly damaging Het
Clca3a2 G T 3: 144,806,478 A499E probably benign Het
Cntnap5b C T 1: 100,358,669 A383V probably benign Het
Ddo T C 10: 40,633,031 V89A probably damaging Het
Depdc5 T C 5: 32,964,507 probably null Het
Dlgap1 T A 17: 70,815,289 D904E probably damaging Het
Ephb4 T A 5: 137,372,085 L849H probably damaging Het
Fbxl13 A G 5: 21,523,547 probably null Het
Fer1l6 C A 15: 58,559,232 Y245* probably null Het
Foxred2 A G 15: 77,955,764 Y109H probably damaging Het
Gabarapl1 A G 6: 129,537,528 D43G probably benign Het
Gbp11 A G 5: 105,325,489 Het
Gm31371 A G 8: 19,924,350 K242E unknown Het
Grin3b C A 10: 79,976,461 A845E probably damaging Het
Hoxd4 A G 2: 74,727,361 Y28C probably damaging Het
Igsf10 G A 3: 59,330,339 T807M probably benign Het
Kcnt1 A G 2: 25,888,755 probably null Het
Kdm5a C A 6: 120,398,978 T565K probably damaging Het
Map7d1 A G 4: 126,236,682 S412P probably damaging Het
Mok A G 12: 110,834,124 probably null Het
Mto1 A T 9: 78,473,835 I73F probably damaging Het
Mtss1l G A 8: 110,732,164 D310N probably damaging Het
Ncf2 T C 1: 152,834,070 Y393H probably damaging Het
Olfr1299 A G 2: 111,664,619 H131R possibly damaging Het
Olfr1317 A C 2: 112,142,406 I154L probably benign Het
Olfr1384 G T 11: 49,514,542 K301N probably damaging Het
Olfr272 A T 4: 52,911,459 C112S probably damaging Het
Olfr38 T C 6: 42,762,657 S202P probably damaging Het
Olfr67 T C 7: 103,788,245 T11A possibly damaging Het
Phxr2 T A 10: 99,126,090 probably benign Het
Rnf17 A G 14: 56,421,169 probably null Het
Serpinb9d T C 13: 33,194,694 M41T probably damaging Het
Slc12a5 T A 2: 164,992,464 probably null Het
Slc22a6 G A 19: 8,622,130 R331H probably benign Het
Spg11 G C 2: 122,112,959 probably null Het
Src T A 2: 157,457,155 V24E probably benign Het
Srgap1 A T 10: 121,925,941 Y101N probably benign Het
Vmn2r30 T A 7: 7,334,308 T110S probably benign Het
Vwa3a A G 7: 120,762,423 E119G possibly damaging Het
Whamm T A 7: 81,591,764 D274E probably damaging Het
Other mutations in Gabrb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Gabrb1 APN 5 72108446 critical splice donor site probably null
IGL00774:Gabrb1 APN 5 72108446 critical splice donor site probably null
IGL01534:Gabrb1 APN 5 71869429 missense possibly damaging 0.95
IGL02170:Gabrb1 APN 5 72136730 missense probably damaging 1.00
IGL02326:Gabrb1 APN 5 71700847 missense probably damaging 0.99
IGL03278:Gabrb1 APN 5 71869596 missense probably damaging 1.00
IGL03345:Gabrb1 APN 5 72136565 missense possibly damaging 0.53
IGL03050:Gabrb1 UTSW 5 72122154 missense probably benign 0.03
R0109:Gabrb1 UTSW 5 72121946 splice site probably benign
R0386:Gabrb1 UTSW 5 72108807 missense probably damaging 0.99
R1512:Gabrb1 UTSW 5 72108704 missense probably damaging 1.00
R1512:Gabrb1 UTSW 5 72108705 missense probably damaging 1.00
R1717:Gabrb1 UTSW 5 72108351 synonymous probably null
R1832:Gabrb1 UTSW 5 72121938 splice site probably null
R1961:Gabrb1 UTSW 5 71700336 missense probably benign 0.28
R2363:Gabrb1 UTSW 5 71869573 nonsense probably null
R4686:Gabrb1 UTSW 5 71700022 missense possibly damaging 0.53
R4840:Gabrb1 UTSW 5 71700811 missense probably damaging 1.00
R4916:Gabrb1 UTSW 5 71869421 missense probably damaging 1.00
R4941:Gabrb1 UTSW 5 72136778 missense probably damaging 1.00
R5250:Gabrb1 UTSW 5 71869579 missense possibly damaging 0.80
R5270:Gabrb1 UTSW 5 72108326 missense probably damaging 1.00
R5364:Gabrb1 UTSW 5 72136762 missense probably benign 0.33
R5407:Gabrb1 UTSW 5 72122021 missense possibly damaging 0.90
R5621:Gabrb1 UTSW 5 72108728 missense probably damaging 1.00
R5790:Gabrb1 UTSW 5 72136484 missense possibly damaging 0.53
R6236:Gabrb1 UTSW 5 72108320 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAATTACTAAACATGATTTGGGG -3'
(R):5'- GTCACTGAAACCTTGAACCATCAG -3'

Sequencing Primer
(F):5'- CTAAACATGATTTGGGGATAGAAAGC -3'
(R):5'- CCTTGAACCATCAGTACTAGGG -3'
Posted On2018-04-02