Incidental Mutation 'R6336:Vwa3a'
ID510761
Institutional Source Beutler Lab
Gene Symbol Vwa3a
Ensembl Gene ENSMUSG00000030889
Gene Namevon Willebrand factor A domain containing 3A
SynonymsE030013G06Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R6336 (G1)
Quality Score210.009
Status Not validated
Chromosome7
Chromosomal Location120739318-120805742 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120762423 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 119 (E119G)
Ref Sequence ENSEMBL: ENSMUSP00000133029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033180] [ENSMUST00000166668] [ENSMUST00000167213] [ENSMUST00000168600]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033180
AA Change: E119G

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000033180
Gene: ENSMUSG00000030889
AA Change: E119G

DomainStartEndE-ValueType
Pfam:VWA_3 142 297 6.3e-30 PFAM
Pfam:VWA_3 483 634 1.2e-17 PFAM
VWA 921 1092 1.89e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000166668
AA Change: E119G

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129136
Gene: ENSMUSG00000030889
AA Change: E119G

DomainStartEndE-ValueType
Pfam:VWA_3 142 297 1.3e-28 PFAM
Pfam:VWA_3 483 633 5.2e-17 PFAM
VWA 921 1092 1.89e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167213
AA Change: E119G

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133029
Gene: ENSMUSG00000030889
AA Change: E119G

DomainStartEndE-ValueType
Pfam:VWA_3 142 297 1.3e-28 PFAM
Pfam:VWA_3 483 633 5.2e-17 PFAM
VWA 921 1092 1.89e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168600
AA Change: E119G

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000132372
Gene: ENSMUSG00000030889
AA Change: E119G

DomainStartEndE-ValueType
Pfam:VWA_3 142 297 8.3e-29 PFAM
Pfam:VWA_3 483 609 5.3e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G T 5: 113,183,483 P955Q possibly damaging Het
Adgrv1 T C 13: 81,385,981 N5827S probably benign Het
Akt3 T C 1: 177,031,712 D431G probably damaging Het
Anapc16 A T 10: 59,988,829 V76D possibly damaging Het
Ankib1 A T 5: 3,700,377 Y755* probably null Het
Ankrd6 A G 4: 32,860,411 S11P probably damaging Het
Card6 T A 15: 5,099,164 K917* probably null Het
Ccdc152 T C 15: 3,301,129 I21M probably damaging Het
Ccdc40 A G 11: 119,231,993 E207G possibly damaging Het
Clca3a2 G T 3: 144,806,478 A499E probably benign Het
Cntnap5b C T 1: 100,358,669 A383V probably benign Het
Ddo T C 10: 40,633,031 V89A probably damaging Het
Depdc5 T C 5: 32,964,507 probably null Het
Dlgap1 T A 17: 70,815,289 D904E probably damaging Het
Ephb4 T A 5: 137,372,085 L849H probably damaging Het
Fbxl13 A G 5: 21,523,547 probably null Het
Fer1l6 C A 15: 58,559,232 Y245* probably null Het
Foxred2 A G 15: 77,955,764 Y109H probably damaging Het
Gabarapl1 A G 6: 129,537,528 D43G probably benign Het
Gabrb1 A C 5: 72,029,898 E178A possibly damaging Het
Gbp11 A G 5: 105,325,489 Het
Gm31371 A G 8: 19,924,350 K242E unknown Het
Grin3b C A 10: 79,976,461 A845E probably damaging Het
Hoxd4 A G 2: 74,727,361 Y28C probably damaging Het
Igsf10 G A 3: 59,330,339 T807M probably benign Het
Kcnt1 A G 2: 25,888,755 probably null Het
Kdm5a C A 6: 120,398,978 T565K probably damaging Het
Map7d1 A G 4: 126,236,682 S412P probably damaging Het
Mok A G 12: 110,834,124 probably null Het
Mto1 A T 9: 78,473,835 I73F probably damaging Het
Mtss1l G A 8: 110,732,164 D310N probably damaging Het
Ncf2 T C 1: 152,834,070 Y393H probably damaging Het
Olfr1299 A G 2: 111,664,619 H131R possibly damaging Het
Olfr1317 A C 2: 112,142,406 I154L probably benign Het
Olfr1384 G T 11: 49,514,542 K301N probably damaging Het
Olfr272 A T 4: 52,911,459 C112S probably damaging Het
Olfr38 T C 6: 42,762,657 S202P probably damaging Het
Olfr67 T C 7: 103,788,245 T11A possibly damaging Het
Phxr2 T A 10: 99,126,090 probably benign Het
Rnf17 A G 14: 56,421,169 probably null Het
Serpinb9d T C 13: 33,194,694 M41T probably damaging Het
Slc12a5 T A 2: 164,992,464 probably null Het
Slc22a6 G A 19: 8,622,130 R331H probably benign Het
Spg11 G C 2: 122,112,959 probably null Het
Src T A 2: 157,457,155 V24E probably benign Het
Srgap1 A T 10: 121,925,941 Y101N probably benign Het
Vmn2r30 T A 7: 7,334,308 T110S probably benign Het
Whamm T A 7: 81,591,764 D274E probably damaging Het
Other mutations in Vwa3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01584:Vwa3a APN 7 120783974 missense probably benign 0.09
IGL01807:Vwa3a APN 7 120775506 splice site probably null
IGL02850:Vwa3a APN 7 120773292 missense probably benign 0.00
IGL03253:Vwa3a APN 7 120778869 missense probably benign 0.03
R0026:Vwa3a UTSW 7 120780211 missense probably damaging 1.00
R0114:Vwa3a UTSW 7 120775380 missense probably benign 0.06
R1145:Vwa3a UTSW 7 120793343 missense probably damaging 0.99
R1145:Vwa3a UTSW 7 120793343 missense probably damaging 0.99
R1306:Vwa3a UTSW 7 120800390 missense possibly damaging 0.49
R1355:Vwa3a UTSW 7 120784111 missense probably damaging 1.00
R1412:Vwa3a UTSW 7 120780154 missense probably damaging 1.00
R1466:Vwa3a UTSW 7 120768165 missense probably damaging 1.00
R1466:Vwa3a UTSW 7 120768165 missense probably damaging 1.00
R1584:Vwa3a UTSW 7 120768165 missense probably damaging 1.00
R1686:Vwa3a UTSW 7 120780148 missense probably damaging 1.00
R1710:Vwa3a UTSW 7 120804031 splice site probably null
R1717:Vwa3a UTSW 7 120793386 missense probably benign
R1834:Vwa3a UTSW 7 120790136 missense probably benign 0.06
R1912:Vwa3a UTSW 7 120795627 missense probably damaging 1.00
R1970:Vwa3a UTSW 7 120780171 missense probably damaging 1.00
R1978:Vwa3a UTSW 7 120758954 missense probably null 0.00
R2034:Vwa3a UTSW 7 120782645 nonsense probably null
R2059:Vwa3a UTSW 7 120758949 missense probably damaging 0.98
R2120:Vwa3a UTSW 7 120792418 missense probably benign
R2408:Vwa3a UTSW 7 120773294 missense probably benign 0.00
R3423:Vwa3a UTSW 7 120799111 missense probably damaging 1.00
R3744:Vwa3a UTSW 7 120752594 missense probably benign
R3816:Vwa3a UTSW 7 120800379 missense probably benign 0.29
R3849:Vwa3a UTSW 7 120762464 nonsense probably null
R3904:Vwa3a UTSW 7 120758876 missense probably benign
R4031:Vwa3a UTSW 7 120768232 critical splice donor site probably null
R4408:Vwa3a UTSW 7 120778926 missense probably benign 0.16
R4628:Vwa3a UTSW 7 120793375 missense probably benign 0.05
R4629:Vwa3a UTSW 7 120793375 missense probably benign 0.05
R4652:Vwa3a UTSW 7 120778915 missense probably damaging 0.96
R4884:Vwa3a UTSW 7 120791701 missense probably benign
R4948:Vwa3a UTSW 7 120776264 missense probably damaging 0.98
R5112:Vwa3a UTSW 7 120783985 missense probably damaging 1.00
R5385:Vwa3a UTSW 7 120790142 missense possibly damaging 0.91
R5386:Vwa3a UTSW 7 120790142 missense possibly damaging 0.91
R5579:Vwa3a UTSW 7 120768173 missense probably benign 0.29
R5587:Vwa3a UTSW 7 120780235 missense probably damaging 1.00
R5639:Vwa3a UTSW 7 120790143 missense probably damaging 0.99
R6102:Vwa3a UTSW 7 120776138 splice site probably null
R6239:Vwa3a UTSW 7 120794234 missense probably benign 0.00
R6279:Vwa3a UTSW 7 120782400 missense probably damaging 0.98
R6298:Vwa3a UTSW 7 120795651 missense probably benign 0.01
R6300:Vwa3a UTSW 7 120782400 missense probably damaging 0.98
R6907:Vwa3a UTSW 7 120792581 unclassified probably benign
V7732:Vwa3a UTSW 7 120778949 splice site probably benign
X0019:Vwa3a UTSW 7 120768209 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCGACTTCAGTTATAGAGTGAGAT -3'
(R):5'- AGCTATGTCTGTGGGCTTCA -3'

Sequencing Primer
(F):5'- AGGGCTATCCAGTGAAACTCTGTC -3'
(R):5'- CTATGTCTGTGGGCTTCATGTCTG -3'
Posted On2018-04-02