Incidental Mutation 'R6336:Mto1'
ID510764
Institutional Source Beutler Lab
Gene Symbol Mto1
Ensembl Gene ENSMUSG00000032342
Gene Namemitochondrial tRNA translation optimization 1
Synonyms5730419A02Rik, 2310039H01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R6336 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location78448208-78475348 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78473835 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 73 (I73F)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034896] [ENSMUST00000042235] [ENSMUST00000148238]
Predicted Effect probably benign
Transcript: ENSMUST00000034896
AA Change: I654F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000034896
Gene: ENSMUSG00000032342
AA Change: I654F

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
Pfam:FAD_binding_2 37 84 1.3e-6 PFAM
Pfam:FAD_oxidored 37 194 2.3e-9 PFAM
Pfam:GIDA 37 435 3.5e-153 PFAM
low complexity region 518 529 N/A INTRINSIC
GIDA_assoc_3 585 658 8.31e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000042235
SMART Domains Protein: ENSMUSP00000042457
Gene: ENSMUSG00000037742

DomainStartEndE-ValueType
Pfam:GTP_EFTU 5 238 3.4e-55 PFAM
Pfam:GTP_EFTU_D2 260 327 6.3e-16 PFAM
Pfam:GTP_EFTU_D3 333 442 5e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129380
Predicted Effect probably damaging
Transcript: ENSMUST00000133002
AA Change: I73F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123414
Gene: ENSMUSG00000032342
AA Change: I73F

DomainStartEndE-ValueType
GIDA_assoc_3 5 78 8.31e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136478
Predicted Effect probably benign
Transcript: ENSMUST00000148238
SMART Domains Protein: ENSMUSP00000121424
Gene: ENSMUSG00000032342

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
Pfam:FAD_binding_2 37 84 7.1e-7 PFAM
Pfam:Pyr_redox_2 37 156 2.1e-7 PFAM
Pfam:FAD_oxidored 37 178 1.1e-9 PFAM
Pfam:GIDA 37 184 8.5e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157051
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial protein thought to be involved in mitochondrial tRNA modification. The encoded protein may also play a role in the expression of the non-syndromic and aminoglycoside-induced deafness phenotypes associated with a specific mutation in the mitochondrial 12S rRNA gene. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a hypomorphic allele show bradycardia, cardiomyopathy, worsening of arrhythmias during induction and reversal of anesthesia, and mitochondrial abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G T 5: 113,183,483 P955Q possibly damaging Het
Adgrv1 T C 13: 81,385,981 N5827S probably benign Het
Akt3 T C 1: 177,031,712 D431G probably damaging Het
Anapc16 A T 10: 59,988,829 V76D possibly damaging Het
Ankib1 A T 5: 3,700,377 Y755* probably null Het
Ankrd6 A G 4: 32,860,411 S11P probably damaging Het
Card6 T A 15: 5,099,164 K917* probably null Het
Ccdc152 T C 15: 3,301,129 I21M probably damaging Het
Ccdc40 A G 11: 119,231,993 E207G possibly damaging Het
Clca3a2 G T 3: 144,806,478 A499E probably benign Het
Cntnap5b C T 1: 100,358,669 A383V probably benign Het
Ddo T C 10: 40,633,031 V89A probably damaging Het
Depdc5 T C 5: 32,964,507 probably null Het
Dlgap1 T A 17: 70,815,289 D904E probably damaging Het
Ephb4 T A 5: 137,372,085 L849H probably damaging Het
Fbxl13 A G 5: 21,523,547 probably null Het
Fer1l6 C A 15: 58,559,232 Y245* probably null Het
Foxred2 A G 15: 77,955,764 Y109H probably damaging Het
Gabarapl1 A G 6: 129,537,528 D43G probably benign Het
Gabrb1 A C 5: 72,029,898 E178A possibly damaging Het
Gbp11 A G 5: 105,325,489 Het
Gm31371 A G 8: 19,924,350 K242E unknown Het
Grin3b C A 10: 79,976,461 A845E probably damaging Het
Hoxd4 A G 2: 74,727,361 Y28C probably damaging Het
Igsf10 G A 3: 59,330,339 T807M probably benign Het
Kcnt1 A G 2: 25,888,755 probably null Het
Kdm5a C A 6: 120,398,978 T565K probably damaging Het
Map7d1 A G 4: 126,236,682 S412P probably damaging Het
Mok A G 12: 110,834,124 probably null Het
Mtss1l G A 8: 110,732,164 D310N probably damaging Het
Ncf2 T C 1: 152,834,070 Y393H probably damaging Het
Olfr1299 A G 2: 111,664,619 H131R possibly damaging Het
Olfr1317 A C 2: 112,142,406 I154L probably benign Het
Olfr1384 G T 11: 49,514,542 K301N probably damaging Het
Olfr272 A T 4: 52,911,459 C112S probably damaging Het
Olfr38 T C 6: 42,762,657 S202P probably damaging Het
Olfr67 T C 7: 103,788,245 T11A possibly damaging Het
Phxr2 T A 10: 99,126,090 probably benign Het
Rnf17 A G 14: 56,421,169 probably null Het
Serpinb9d T C 13: 33,194,694 M41T probably damaging Het
Slc12a5 T A 2: 164,992,464 probably null Het
Slc22a6 G A 19: 8,622,130 R331H probably benign Het
Spg11 G C 2: 122,112,959 probably null Het
Src T A 2: 157,457,155 V24E probably benign Het
Srgap1 A T 10: 121,925,941 Y101N probably benign Het
Vmn2r30 T A 7: 7,334,308 T110S probably benign Het
Vwa3a A G 7: 120,762,423 E119G possibly damaging Het
Whamm T A 7: 81,591,764 D274E probably damaging Het
Other mutations in Mto1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01010:Mto1 APN 9 78461643 missense probably benign 0.00
IGL01362:Mto1 APN 9 78452774 missense probably benign 0.00
IGL01906:Mto1 APN 9 78464931 missense probably benign
IGL02499:Mto1 APN 9 78461512 splice site probably benign
IGL02504:Mto1 APN 9 78460927 missense probably damaging 1.00
IGL03104:Mto1 APN 9 78449520 missense probably damaging 1.00
R0089:Mto1 UTSW 9 78473872 missense probably benign
R0325:Mto1 UTSW 9 78453004 missense probably damaging 1.00
R0566:Mto1 UTSW 9 78448301 missense possibly damaging 0.66
R0659:Mto1 UTSW 9 78457508 missense probably damaging 1.00
R0659:Mto1 UTSW 9 78470790 missense probably damaging 1.00
R0837:Mto1 UTSW 9 78473790 missense probably damaging 1.00
R1679:Mto1 UTSW 9 78464963 missense probably benign
R1899:Mto1 UTSW 9 78461517 splice site probably benign
R1900:Mto1 UTSW 9 78461517 splice site probably benign
R2235:Mto1 UTSW 9 78457564 missense possibly damaging 0.58
R3078:Mto1 UTSW 9 78458028 missense probably damaging 1.00
R5015:Mto1 UTSW 9 78461621 missense probably benign 0.25
R5420:Mto1 UTSW 9 78452827 missense probably benign
R5947:Mto1 UTSW 9 78461029 missense probably damaging 1.00
R5969:Mto1 UTSW 9 78452905 missense probably damaging 1.00
R6092:Mto1 UTSW 9 78460849 missense possibly damaging 0.95
R6542:Mto1 UTSW 9 78457228 missense possibly damaging 0.94
R7092:Mto1 UTSW 9 78470673 missense not run
R7150:Mto1 UTSW 9 78457283 missense not run
Predicted Primers PCR Primer
(F):5'- GTCATAAGTCATGTCTCATTTCCCT -3'
(R):5'- GCTTGAGACTCCCACAGGG -3'

Sequencing Primer
(F):5'- GGAGGATCTCTTTACTTAGCCCAAG -3'
(R):5'- AAATAATTGTGTGTTTGGGGCTCACC -3'
Posted On2018-04-02