Incidental Mutation 'R6336:Ddo'
ID510765
Institutional Source Beutler Lab
Gene Symbol Ddo
Ensembl Gene ENSMUSG00000063428
Gene NameD-aspartate oxidase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6336 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location40630011-40681847 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40633031 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 89 (V89A)
Ref Sequence ENSEMBL: ENSMUSP00000151066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019977] [ENSMUST00000213442] [ENSMUST00000213503] [ENSMUST00000213856] [ENSMUST00000214102] [ENSMUST00000216830]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019977
AA Change: V89A

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000019977
Gene: ENSMUSG00000063428
AA Change: V89A

DomainStartEndE-ValueType
Pfam:DAO 5 324 5.1e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213442
AA Change: V89A

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000213503
AA Change: V89A

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000213856
Predicted Effect possibly damaging
Transcript: ENSMUST00000214102
AA Change: V98A

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214618
Predicted Effect possibly damaging
Transcript: ENSMUST00000216830
AA Change: V89A

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a peroxisomal flavoprotein that catalyzes the oxidative deamination of D-aspartate and N-methyl D-aspartate. Flavin adenine dinucleotide or 6-hydroxyflavin adenine dinucleotide can serve as the cofactor in this reaction. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile, but can display impaired male copulation, decreased autogrooming, increased body weight, and increased D-aspartate levels, depending on the mutant allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G T 5: 113,183,483 P955Q possibly damaging Het
Adgrv1 T C 13: 81,385,981 N5827S probably benign Het
Akt3 T C 1: 177,031,712 D431G probably damaging Het
Anapc16 A T 10: 59,988,829 V76D possibly damaging Het
Ankib1 A T 5: 3,700,377 Y755* probably null Het
Ankrd6 A G 4: 32,860,411 S11P probably damaging Het
Card6 T A 15: 5,099,164 K917* probably null Het
Ccdc152 T C 15: 3,301,129 I21M probably damaging Het
Ccdc40 A G 11: 119,231,993 E207G possibly damaging Het
Clca3a2 G T 3: 144,806,478 A499E probably benign Het
Cntnap5b C T 1: 100,358,669 A383V probably benign Het
Depdc5 T C 5: 32,964,507 probably null Het
Dlgap1 T A 17: 70,815,289 D904E probably damaging Het
Ephb4 T A 5: 137,372,085 L849H probably damaging Het
Fbxl13 A G 5: 21,523,547 probably null Het
Fer1l6 C A 15: 58,559,232 Y245* probably null Het
Foxred2 A G 15: 77,955,764 Y109H probably damaging Het
Gabarapl1 A G 6: 129,537,528 D43G probably benign Het
Gabrb1 A C 5: 72,029,898 E178A possibly damaging Het
Gbp11 A G 5: 105,325,489 Het
Gm31371 A G 8: 19,924,350 K242E unknown Het
Grin3b C A 10: 79,976,461 A845E probably damaging Het
Hoxd4 A G 2: 74,727,361 Y28C probably damaging Het
Igsf10 G A 3: 59,330,339 T807M probably benign Het
Kcnt1 A G 2: 25,888,755 probably null Het
Kdm5a C A 6: 120,398,978 T565K probably damaging Het
Map7d1 A G 4: 126,236,682 S412P probably damaging Het
Mok A G 12: 110,834,124 probably null Het
Mto1 A T 9: 78,473,835 I73F probably damaging Het
Mtss1l G A 8: 110,732,164 D310N probably damaging Het
Ncf2 T C 1: 152,834,070 Y393H probably damaging Het
Olfr1299 A G 2: 111,664,619 H131R possibly damaging Het
Olfr1317 A C 2: 112,142,406 I154L probably benign Het
Olfr1384 G T 11: 49,514,542 K301N probably damaging Het
Olfr272 A T 4: 52,911,459 C112S probably damaging Het
Olfr38 T C 6: 42,762,657 S202P probably damaging Het
Olfr67 T C 7: 103,788,245 T11A possibly damaging Het
Phxr2 T A 10: 99,126,090 probably benign Het
Rnf17 A G 14: 56,421,169 probably null Het
Serpinb9d T C 13: 33,194,694 M41T probably damaging Het
Slc12a5 T A 2: 164,992,464 probably null Het
Slc22a6 G A 19: 8,622,130 R331H probably benign Het
Spg11 G C 2: 122,112,959 probably null Het
Src T A 2: 157,457,155 V24E probably benign Het
Srgap1 A T 10: 121,925,941 Y101N probably benign Het
Vmn2r30 T A 7: 7,334,308 T110S probably benign Het
Vwa3a A G 7: 120,762,423 E119G possibly damaging Het
Whamm T A 7: 81,591,764 D274E probably damaging Het
Other mutations in Ddo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Ddo APN 10 40647554 missense probably damaging 1.00
IGL01784:Ddo APN 10 40631788 splice site probably benign
IGL01891:Ddo APN 10 40647647 missense possibly damaging 0.95
IGL02559:Ddo APN 10 40647521 missense probably damaging 1.00
IGL02639:Ddo APN 10 40647737 missense probably damaging 1.00
IGL02884:Ddo APN 10 40637364 missense probably benign 0.01
R1796:Ddo UTSW 10 40647629 missense probably benign 0.32
R2512:Ddo UTSW 10 40632939 missense possibly damaging 0.56
R3054:Ddo UTSW 10 40631742 missense probably benign 0.37
R4454:Ddo UTSW 10 40647547 missense probably damaging 0.97
R5517:Ddo UTSW 10 40647730 missense probably benign 0.00
R6516:Ddo UTSW 10 40631745 missense probably damaging 1.00
R6872:Ddo UTSW 10 40637418 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- CTCCCTGAGTATCTTTGTGGCAG -3'
(R):5'- AACCACTTCACATTCCTTCAGG -3'

Sequencing Primer
(F):5'- AGTATCTTTGTGGCAGAAGCATG -3'
(R):5'- CAATGTACTATGCATGTGTTAC -3'
Posted On2018-04-02