Incidental Mutation 'R6336:Anapc16'
ID510766
Institutional Source Beutler Lab
Gene Symbol Anapc16
Ensembl Gene ENSMUSG00000020107
Gene Nameanaphase promoting complex subunit 16
SynonymsD10Ertd641e, 2310005G07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.388) question?
Stock #R6336 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location59987409-60003135 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59988829 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 76 (V76D)
Ref Sequence ENSEMBL: ENSMUSP00000138112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020307] [ENSMUST00000182116] [ENSMUST00000182152] [ENSMUST00000182898] [ENSMUST00000182912]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020307
AA Change: V95D

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020307
Gene: ENSMUSG00000020107
AA Change: V95D

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182116
Predicted Effect possibly damaging
Transcript: ENSMUST00000182152
AA Change: V95D

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138579
Gene: ENSMUSG00000020107
AA Change: V95D

DomainStartEndE-ValueType
low complexity region 21 45 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000182898
AA Change: V76D

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138112
Gene: ENSMUSG00000020107
AA Change: V76D

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182912
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183093
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G T 5: 113,183,483 P955Q possibly damaging Het
Adgrv1 T C 13: 81,385,981 N5827S probably benign Het
Akt3 T C 1: 177,031,712 D431G probably damaging Het
Ankib1 A T 5: 3,700,377 Y755* probably null Het
Ankrd6 A G 4: 32,860,411 S11P probably damaging Het
Card6 T A 15: 5,099,164 K917* probably null Het
Ccdc152 T C 15: 3,301,129 I21M probably damaging Het
Ccdc40 A G 11: 119,231,993 E207G possibly damaging Het
Clca3a2 G T 3: 144,806,478 A499E probably benign Het
Cntnap5b C T 1: 100,358,669 A383V probably benign Het
Ddo T C 10: 40,633,031 V89A probably damaging Het
Depdc5 T C 5: 32,964,507 probably null Het
Dlgap1 T A 17: 70,815,289 D904E probably damaging Het
Ephb4 T A 5: 137,372,085 L849H probably damaging Het
Fbxl13 A G 5: 21,523,547 probably null Het
Fer1l6 C A 15: 58,559,232 Y245* probably null Het
Foxred2 A G 15: 77,955,764 Y109H probably damaging Het
Gabarapl1 A G 6: 129,537,528 D43G probably benign Het
Gabrb1 A C 5: 72,029,898 E178A possibly damaging Het
Gbp11 A G 5: 105,325,489 Het
Gm31371 A G 8: 19,924,350 K242E unknown Het
Grin3b C A 10: 79,976,461 A845E probably damaging Het
Hoxd4 A G 2: 74,727,361 Y28C probably damaging Het
Igsf10 G A 3: 59,330,339 T807M probably benign Het
Kcnt1 A G 2: 25,888,755 probably null Het
Kdm5a C A 6: 120,398,978 T565K probably damaging Het
Map7d1 A G 4: 126,236,682 S412P probably damaging Het
Mok A G 12: 110,834,124 probably null Het
Mto1 A T 9: 78,473,835 I73F probably damaging Het
Mtss1l G A 8: 110,732,164 D310N probably damaging Het
Ncf2 T C 1: 152,834,070 Y393H probably damaging Het
Olfr1299 A G 2: 111,664,619 H131R possibly damaging Het
Olfr1317 A C 2: 112,142,406 I154L probably benign Het
Olfr1384 G T 11: 49,514,542 K301N probably damaging Het
Olfr272 A T 4: 52,911,459 C112S probably damaging Het
Olfr38 T C 6: 42,762,657 S202P probably damaging Het
Olfr67 T C 7: 103,788,245 T11A possibly damaging Het
Phxr2 T A 10: 99,126,090 probably benign Het
Rnf17 A G 14: 56,421,169 probably null Het
Serpinb9d T C 13: 33,194,694 M41T probably damaging Het
Slc12a5 T A 2: 164,992,464 probably null Het
Slc22a6 G A 19: 8,622,130 R331H probably benign Het
Spg11 G C 2: 122,112,959 probably null Het
Src T A 2: 157,457,155 V24E probably benign Het
Srgap1 A T 10: 121,925,941 Y101N probably benign Het
Vmn2r30 T A 7: 7,334,308 T110S probably benign Het
Vwa3a A G 7: 120,762,423 E119G possibly damaging Het
Whamm T A 7: 81,591,764 D274E probably damaging Het
Other mutations in Anapc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01796:Anapc16 APN 10 59988757 missense possibly damaging 0.80
R1386:Anapc16 UTSW 10 59996457 missense probably benign 0.02
R2246:Anapc16 UTSW 10 59996476 nonsense probably null
R2376:Anapc16 UTSW 10 59988757 missense possibly damaging 0.80
R4492:Anapc16 UTSW 10 59990902 missense possibly damaging 0.86
R7133:Anapc16 UTSW 10 59996480 missense not run
Predicted Primers PCR Primer
(F):5'- TCACAGGACAGCTGTGACTC -3'
(R):5'- TCCACTAACTCAAGCAAAGGGG -3'

Sequencing Primer
(F):5'- ACAGCTGTGACTCCCTGG -3'
(R):5'- GGGGAGACGTGCATAATGC -3'
Posted On2018-04-02