Incidental Mutation 'R6336:Srgap1'
ID510769
Institutional Source Beutler Lab
Gene Symbol Srgap1
Ensembl Gene ENSMUSG00000020121
Gene NameSLIT-ROBO Rho GTPase activating protein 1
SynonymsArhgap13, 4930572H05Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R6336 (G1)
Quality Score209.009
Status Validated
Chromosome10
Chromosomal Location121780991-122047315 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121925941 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 101 (Y101N)
Ref Sequence ENSEMBL: ENSMUSP00000080389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020322] [ENSMUST00000081688]
Predicted Effect probably benign
Transcript: ENSMUST00000020322
AA Change: Y101N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000020322
Gene: ENSMUSG00000020121
AA Change: Y101N

DomainStartEndE-ValueType
FCH 22 121 3.81e-16 SMART
low complexity region 173 193 N/A INTRINSIC
coiled coil region 352 382 N/A INTRINSIC
low complexity region 405 418 N/A INTRINSIC
RhoGAP 494 668 1.27e-64 SMART
SH3 723 778 1.57e-14 SMART
low complexity region 826 840 N/A INTRINSIC
low complexity region 1004 1014 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081688
AA Change: Y101N

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000080389
Gene: ENSMUSG00000020121
AA Change: Y101N

DomainStartEndE-ValueType
FCH 22 121 3.81e-16 SMART
low complexity region 173 193 N/A INTRINSIC
coiled coil region 352 382 N/A INTRINSIC
low complexity region 405 418 N/A INTRINSIC
RhoGAP 517 691 1.27e-64 SMART
SH3 746 801 1.57e-14 SMART
low complexity region 849 863 N/A INTRINSIC
low complexity region 1027 1037 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162710
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase activator, working with the GTPase CDC42 to negatively regulate neuronal migration. The encoded protein interacts with the transmembrane receptor ROBO1 to inactivate CDC42. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G T 5: 113,183,483 P955Q possibly damaging Het
Adgrv1 T C 13: 81,385,981 N5827S probably benign Het
Akt3 T C 1: 177,031,712 D431G probably damaging Het
Anapc16 A T 10: 59,988,829 V76D possibly damaging Het
Ankib1 A T 5: 3,700,377 Y755* probably null Het
Ankrd6 A G 4: 32,860,411 S11P probably damaging Het
Card6 T A 15: 5,099,164 K917* probably null Het
Ccdc152 T C 15: 3,301,129 I21M probably damaging Het
Ccdc40 A G 11: 119,231,993 E207G possibly damaging Het
Clca3a2 G T 3: 144,806,478 A499E probably benign Het
Cntnap5b C T 1: 100,358,669 A383V probably benign Het
Ddo T C 10: 40,633,031 V89A probably damaging Het
Depdc5 T C 5: 32,964,507 probably null Het
Dlgap1 T A 17: 70,815,289 D904E probably damaging Het
Ephb4 T A 5: 137,372,085 L849H probably damaging Het
Fbxl13 A G 5: 21,523,547 probably null Het
Fer1l6 C A 15: 58,559,232 Y245* probably null Het
Foxred2 A G 15: 77,955,764 Y109H probably damaging Het
Gabarapl1 A G 6: 129,537,528 D43G probably benign Het
Gabrb1 A C 5: 72,029,898 E178A possibly damaging Het
Gbp11 A G 5: 105,325,489 Het
Gm31371 A G 8: 19,924,350 K242E unknown Het
Grin3b C A 10: 79,976,461 A845E probably damaging Het
Hoxd4 A G 2: 74,727,361 Y28C probably damaging Het
Igsf10 G A 3: 59,330,339 T807M probably benign Het
Kcnt1 A G 2: 25,888,755 probably null Het
Kdm5a C A 6: 120,398,978 T565K probably damaging Het
Map7d1 A G 4: 126,236,682 S412P probably damaging Het
Mok A G 12: 110,834,124 probably null Het
Mto1 A T 9: 78,473,835 I73F probably damaging Het
Mtss1l G A 8: 110,732,164 D310N probably damaging Het
Ncf2 T C 1: 152,834,070 Y393H probably damaging Het
Olfr1299 A G 2: 111,664,619 H131R possibly damaging Het
Olfr1317 A C 2: 112,142,406 I154L probably benign Het
Olfr1384 G T 11: 49,514,542 K301N probably damaging Het
Olfr272 A T 4: 52,911,459 C112S probably damaging Het
Olfr38 T C 6: 42,762,657 S202P probably damaging Het
Olfr67 T C 7: 103,788,245 T11A possibly damaging Het
Phxr2 T A 10: 99,126,090 probably benign Het
Rnf17 A G 14: 56,421,169 probably null Het
Serpinb9d T C 13: 33,194,694 M41T probably damaging Het
Slc12a5 T A 2: 164,992,464 probably null Het
Slc22a6 G A 19: 8,622,130 R331H probably benign Het
Spg11 G C 2: 122,112,959 probably null Het
Src T A 2: 157,457,155 V24E probably benign Het
Vmn2r30 T A 7: 7,334,308 T110S probably benign Het
Vwa3a A G 7: 120,762,423 E119G possibly damaging Het
Whamm T A 7: 81,591,764 D274E probably damaging Het
Other mutations in Srgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01964:Srgap1 APN 10 121804966 missense possibly damaging 0.81
IGL02106:Srgap1 APN 10 121785693 missense possibly damaging 0.95
IGL02927:Srgap1 APN 10 121855462 missense probably damaging 0.99
IGL03088:Srgap1 APN 10 121825693 missense possibly damaging 0.94
IGL03208:Srgap1 APN 10 121792266 missense possibly damaging 0.89
IGL03251:Srgap1 APN 10 121804921 unclassified probably null
PIT1430001:Srgap1 UTSW 10 121896753 splice site probably benign
R0052:Srgap1 UTSW 10 121800827 missense possibly damaging 0.94
R0052:Srgap1 UTSW 10 121800827 missense possibly damaging 0.94
R0356:Srgap1 UTSW 10 121855536 splice site probably null
R0361:Srgap1 UTSW 10 122047192 start codon destroyed probably null 0.89
R0365:Srgap1 UTSW 10 121785705 missense possibly damaging 0.80
R0675:Srgap1 UTSW 10 121792235 missense probably damaging 1.00
R0801:Srgap1 UTSW 10 121807875 missense probably damaging 0.96
R0815:Srgap1 UTSW 10 121785474 missense probably damaging 0.99
R1034:Srgap1 UTSW 10 121785445 missense possibly damaging 0.69
R1160:Srgap1 UTSW 10 121855477 missense probably benign 0.01
R1454:Srgap1 UTSW 10 121896738 missense probably damaging 0.99
R1624:Srgap1 UTSW 10 121855373 missense probably benign 0.03
R1628:Srgap1 UTSW 10 121870339 missense probably benign 0.15
R1816:Srgap1 UTSW 10 121925971 nonsense probably null
R1933:Srgap1 UTSW 10 121925903 missense possibly damaging 0.89
R2034:Srgap1 UTSW 10 121792746 missense probably damaging 0.98
R2211:Srgap1 UTSW 10 121853740 missense possibly damaging 0.55
R2295:Srgap1 UTSW 10 121794760 missense probably benign 0.03
R2368:Srgap1 UTSW 10 121829289 missense probably benign 0.05
R3796:Srgap1 UTSW 10 122047132 missense probably benign 0.06
R4083:Srgap1 UTSW 10 121785690 missense probably damaging 1.00
R4172:Srgap1 UTSW 10 121855363 missense probably benign 0.00
R4322:Srgap1 UTSW 10 121869806 missense probably damaging 1.00
R4401:Srgap1 UTSW 10 121804921 unclassified probably null
R4513:Srgap1 UTSW 10 121870326 critical splice donor site probably null
R4698:Srgap1 UTSW 10 121792487 missense probably benign 0.22
R4776:Srgap1 UTSW 10 121792351 missense probably benign 0.03
R4951:Srgap1 UTSW 10 121785552 missense probably benign 0.20
R5116:Srgap1 UTSW 10 121792379 missense possibly damaging 0.77
R5232:Srgap1 UTSW 10 121840911 missense probably benign 0.00
R5237:Srgap1 UTSW 10 121807883 missense probably damaging 1.00
R5335:Srgap1 UTSW 10 121785377 utr 3 prime probably benign
R5402:Srgap1 UTSW 10 121785760 missense probably benign 0.06
R5432:Srgap1 UTSW 10 121869823 missense probably damaging 1.00
R5456:Srgap1 UTSW 10 121869811 missense probably benign 0.45
R5669:Srgap1 UTSW 10 121804850 missense probably benign 0.00
R5682:Srgap1 UTSW 10 121805014 missense probably damaging 1.00
R5687:Srgap1 UTSW 10 121825636 missense probably damaging 1.00
R5773:Srgap1 UTSW 10 121896709 missense probably benign 0.02
R5832:Srgap1 UTSW 10 121840914 missense probably damaging 1.00
R6028:Srgap1 UTSW 10 121828730 missense probably null
R6240:Srgap1 UTSW 10 122047156 missense probably benign 0.06
R6435:Srgap1 UTSW 10 121800827 missense possibly damaging 0.94
R6597:Srgap1 UTSW 10 121792371 missense probably benign 0.11
R6798:Srgap1 UTSW 10 121925904 missense probably damaging 1.00
R6897:Srgap1 UTSW 10 121785618 missense probably damaging 0.96
X0063:Srgap1 UTSW 10 121785412 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGGCTATCTGGAAGCACACC -3'
(R):5'- GGCCTGATAAGTTGCAGGATCC -3'

Sequencing Primer
(F):5'- TATCTGGAAGCACACCATGGCAG -3'
(R):5'- TGTAGCGTGCCCTGATCTAAGAAAC -3'
Posted On2018-04-02