Incidental Mutation 'R6336:Mok'
ID510772
Institutional Source Beutler Lab
Gene Symbol Mok
Ensembl Gene ENSMUSG00000056458
Gene NameMOK protein kinase
SynonymsStk30, MAPK/MAK/MRK/ overlapping kinase, MOK, Rage
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R6336 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location110807798-110840939 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 110834124 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070565] [ENSMUST00000084974] [ENSMUST00000177224]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000021701
Predicted Effect probably null
Transcript: ENSMUST00000070565
SMART Domains Protein: ENSMUSP00000068904
Gene: ENSMUSG00000056458

DomainStartEndE-ValueType
S_TKc 4 285 6.78e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084974
SMART Domains Protein: ENSMUSP00000082041
Gene: ENSMUSG00000056458

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 138 8.4e-20 PFAM
Pfam:Pkinase 1 168 4.9e-36 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000177224
SMART Domains Protein: ENSMUSP00000135791
Gene: ENSMUSG00000056458

DomainStartEndE-ValueType
Pfam:Pkinase 4 70 2e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the MAP kinase superfamily. The gene was found to be regulated by caudal type transcription factor 2 (Cdx2) protein. The encoded protein, which is localized to epithelial cells in the intestinal crypt, may play a role in growth arrest and differentiation of cells of upper crypt and lower villus regions. Multiple alternatively spliced transcript variants encoding different isoforms have been observed for this gene. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G T 5: 113,183,483 P955Q possibly damaging Het
Adgrv1 T C 13: 81,385,981 N5827S probably benign Het
Akt3 T C 1: 177,031,712 D431G probably damaging Het
Anapc16 A T 10: 59,988,829 V76D possibly damaging Het
Ankib1 A T 5: 3,700,377 Y755* probably null Het
Ankrd6 A G 4: 32,860,411 S11P probably damaging Het
Card6 T A 15: 5,099,164 K917* probably null Het
Ccdc152 T C 15: 3,301,129 I21M probably damaging Het
Ccdc40 A G 11: 119,231,993 E207G possibly damaging Het
Clca3a2 G T 3: 144,806,478 A499E probably benign Het
Cntnap5b C T 1: 100,358,669 A383V probably benign Het
Ddo T C 10: 40,633,031 V89A probably damaging Het
Depdc5 T C 5: 32,964,507 probably null Het
Dlgap1 T A 17: 70,815,289 D904E probably damaging Het
Ephb4 T A 5: 137,372,085 L849H probably damaging Het
Fbxl13 A G 5: 21,523,547 probably null Het
Fer1l6 C A 15: 58,559,232 Y245* probably null Het
Foxred2 A G 15: 77,955,764 Y109H probably damaging Het
Gabarapl1 A G 6: 129,537,528 D43G probably benign Het
Gabrb1 A C 5: 72,029,898 E178A possibly damaging Het
Gbp11 A G 5: 105,325,489 Het
Gm31371 A G 8: 19,924,350 K242E unknown Het
Grin3b C A 10: 79,976,461 A845E probably damaging Het
Hoxd4 A G 2: 74,727,361 Y28C probably damaging Het
Igsf10 G A 3: 59,330,339 T807M probably benign Het
Kcnt1 A G 2: 25,888,755 probably null Het
Kdm5a C A 6: 120,398,978 T565K probably damaging Het
Map7d1 A G 4: 126,236,682 S412P probably damaging Het
Mto1 A T 9: 78,473,835 I73F probably damaging Het
Mtss1l G A 8: 110,732,164 D310N probably damaging Het
Ncf2 T C 1: 152,834,070 Y393H probably damaging Het
Olfr1299 A G 2: 111,664,619 H131R possibly damaging Het
Olfr1317 A C 2: 112,142,406 I154L probably benign Het
Olfr1384 G T 11: 49,514,542 K301N probably damaging Het
Olfr272 A T 4: 52,911,459 C112S probably damaging Het
Olfr38 T C 6: 42,762,657 S202P probably damaging Het
Olfr67 T C 7: 103,788,245 T11A possibly damaging Het
Phxr2 T A 10: 99,126,090 probably benign Het
Rnf17 A G 14: 56,421,169 probably null Het
Serpinb9d T C 13: 33,194,694 M41T probably damaging Het
Slc12a5 T A 2: 164,992,464 probably null Het
Slc22a6 G A 19: 8,622,130 R331H probably benign Het
Spg11 G C 2: 122,112,959 probably null Het
Src T A 2: 157,457,155 V24E probably benign Het
Srgap1 A T 10: 121,925,941 Y101N probably benign Het
Vmn2r30 T A 7: 7,334,308 T110S probably benign Het
Vwa3a A G 7: 120,762,423 E119G possibly damaging Het
Whamm T A 7: 81,591,764 D274E probably damaging Het
Other mutations in Mok
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Mok APN 12 110808197 unclassified probably benign
IGL01925:Mok APN 12 110808212 missense probably benign 0.15
IGL02660:Mok APN 12 110828065 missense probably damaging 0.99
R0256:Mok UTSW 12 110808105 missense probably damaging 1.00
R1797:Mok UTSW 12 110808045 missense probably benign 0.28
R2022:Mok UTSW 12 110811823 missense probably benign 0.00
R2175:Mok UTSW 12 110815200 missense probably benign 0.01
R3840:Mok UTSW 12 110815157 missense probably benign 0.04
R3841:Mok UTSW 12 110815157 missense probably benign 0.04
R4645:Mok UTSW 12 110808439 unclassified probably benign
R5711:Mok UTSW 12 110808069 missense probably damaging 1.00
R6084:Mok UTSW 12 110814946 missense probably benign 0.01
R6544:Mok UTSW 12 110810755 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTAGTCACTGACATTACCACC -3'
(R):5'- GTTGTCGTGAAATTACGCAGAG -3'

Sequencing Primer
(F):5'- GTCACTGACATTACCACCAACTTGG -3'
(R):5'- TTACGCAGAGGAAAAAGTCTGTAGTG -3'
Posted On2018-04-02