Incidental Mutation 'R6336:Fer1l6'
ID510777
Institutional Source Beutler Lab
Gene Symbol Fer1l6
Ensembl Gene ENSMUSG00000037106
Gene Namefer-1-like 6 (C. elegans)
SynonymsEG631797
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R6336 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location58510048-58665092 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 58559232 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 245 (Y245*)
Ref Sequence ENSEMBL: ENSMUSP00000125718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161028]
Predicted Effect probably null
Transcript: ENSMUST00000161028
AA Change: Y245*
SMART Domains Protein: ENSMUSP00000125718
Gene: ENSMUSG00000037106
AA Change: Y245*

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
C2 83 179 4.09e-12 SMART
FerI 165 235 2.06e-36 SMART
C2 243 354 5.19e-14 SMART
low complexity region 412 449 N/A INTRINSIC
FerB 714 787 2.53e-45 SMART
C2 829 936 8.84e-8 SMART
C2 1000 1099 3.05e0 SMART
low complexity region 1189 1203 N/A INTRINSIC
low complexity region 1256 1270 N/A INTRINSIC
C2 1361 1460 5.78e-12 SMART
low complexity region 1518 1529 N/A INTRINSIC
C2 1601 1731 1.01e-2 SMART
Pfam:Ferlin_C 1765 1857 2.3e-40 PFAM
Meta Mutation Damage Score 0.6276 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G T 5: 113,183,483 P955Q possibly damaging Het
Adgrv1 T C 13: 81,385,981 N5827S probably benign Het
Akt3 T C 1: 177,031,712 D431G probably damaging Het
Anapc16 A T 10: 59,988,829 V76D possibly damaging Het
Ankib1 A T 5: 3,700,377 Y755* probably null Het
Ankrd6 A G 4: 32,860,411 S11P probably damaging Het
Card6 T A 15: 5,099,164 K917* probably null Het
Ccdc152 T C 15: 3,301,129 I21M probably damaging Het
Ccdc40 A G 11: 119,231,993 E207G possibly damaging Het
Clca3a2 G T 3: 144,806,478 A499E probably benign Het
Cntnap5b C T 1: 100,358,669 A383V probably benign Het
Ddo T C 10: 40,633,031 V89A probably damaging Het
Depdc5 T C 5: 32,964,507 probably null Het
Dlgap1 T A 17: 70,815,289 D904E probably damaging Het
Ephb4 T A 5: 137,372,085 L849H probably damaging Het
Fbxl13 A G 5: 21,523,547 probably null Het
Foxred2 A G 15: 77,955,764 Y109H probably damaging Het
Gabarapl1 A G 6: 129,537,528 D43G probably benign Het
Gabrb1 A C 5: 72,029,898 E178A possibly damaging Het
Gbp11 A G 5: 105,325,489 Het
Gm31371 A G 8: 19,924,350 K242E unknown Het
Grin3b C A 10: 79,976,461 A845E probably damaging Het
Hoxd4 A G 2: 74,727,361 Y28C probably damaging Het
Igsf10 G A 3: 59,330,339 T807M probably benign Het
Kcnt1 A G 2: 25,888,755 probably null Het
Kdm5a C A 6: 120,398,978 T565K probably damaging Het
Map7d1 A G 4: 126,236,682 S412P probably damaging Het
Mok A G 12: 110,834,124 probably null Het
Mto1 A T 9: 78,473,835 I73F probably damaging Het
Mtss1l G A 8: 110,732,164 D310N probably damaging Het
Ncf2 T C 1: 152,834,070 Y393H probably damaging Het
Olfr1299 A G 2: 111,664,619 H131R possibly damaging Het
Olfr1317 A C 2: 112,142,406 I154L probably benign Het
Olfr1384 G T 11: 49,514,542 K301N probably damaging Het
Olfr272 A T 4: 52,911,459 C112S probably damaging Het
Olfr38 T C 6: 42,762,657 S202P probably damaging Het
Olfr67 T C 7: 103,788,245 T11A possibly damaging Het
Phxr2 T A 10: 99,126,090 probably benign Het
Rnf17 A G 14: 56,421,169 probably null Het
Serpinb9d T C 13: 33,194,694 M41T probably damaging Het
Slc12a5 T A 2: 164,992,464 probably null Het
Slc22a6 G A 19: 8,622,130 R331H probably benign Het
Spg11 G C 2: 122,112,959 probably null Het
Src T A 2: 157,457,155 V24E probably benign Het
Srgap1 A T 10: 121,925,941 Y101N probably benign Het
Vmn2r30 T A 7: 7,334,308 T110S probably benign Het
Vwa3a A G 7: 120,762,423 E119G possibly damaging Het
Whamm T A 7: 81,591,764 D274E probably damaging Het
Other mutations in Fer1l6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0009:Fer1l6 UTSW 15 58662787 missense probably damaging 1.00
R0141:Fer1l6 UTSW 15 58558402 missense probably damaging 1.00
R0178:Fer1l6 UTSW 15 58637914 splice site probably null
R0304:Fer1l6 UTSW 15 58590562 missense probably benign 0.08
R0379:Fer1l6 UTSW 15 58548338 missense probably benign 0.05
R0457:Fer1l6 UTSW 15 58638094 critical splice donor site probably null
R0546:Fer1l6 UTSW 15 58558408 splice site probably null
R0602:Fer1l6 UTSW 15 58577945 missense probably damaging 0.98
R0619:Fer1l6 UTSW 15 58662935 unclassified probably null
R0669:Fer1l6 UTSW 15 58553724 splice site probably null
R0854:Fer1l6 UTSW 15 58559188 missense probably benign 0.00
R0948:Fer1l6 UTSW 15 58564075 missense probably benign 0.00
R1180:Fer1l6 UTSW 15 58602311 splice site probably benign
R1483:Fer1l6 UTSW 15 58637970 missense possibly damaging 0.84
R1627:Fer1l6 UTSW 15 58641879 missense probably benign 0.41
R1635:Fer1l6 UTSW 15 58647081 missense probably damaging 1.00
R1834:Fer1l6 UTSW 15 58557869 missense possibly damaging 0.58
R1921:Fer1l6 UTSW 15 58625231 missense probably damaging 1.00
R2000:Fer1l6 UTSW 15 58602311 splice site probably benign
R2041:Fer1l6 UTSW 15 58558306 missense probably damaging 1.00
R2144:Fer1l6 UTSW 15 58627534 missense probably benign
R2145:Fer1l6 UTSW 15 58627534 missense probably benign
R2981:Fer1l6 UTSW 15 58564077 missense probably damaging 0.99
R4164:Fer1l6 UTSW 15 58559238 missense possibly damaging 0.83
R4192:Fer1l6 UTSW 15 58647149 missense probably damaging 1.00
R4273:Fer1l6 UTSW 15 58627522 missense probably benign 0.41
R4573:Fer1l6 UTSW 15 58626280 critical splice donor site probably null
R4581:Fer1l6 UTSW 15 58640226 missense probably damaging 1.00
R4624:Fer1l6 UTSW 15 58553705 missense probably damaging 1.00
R4755:Fer1l6 UTSW 15 58640211 missense probably benign 0.09
R4774:Fer1l6 UTSW 15 58577949 missense probably damaging 0.99
R4894:Fer1l6 UTSW 15 58618902 missense probably damaging 1.00
R4896:Fer1l6 UTSW 15 58638020 missense probably damaging 1.00
R4921:Fer1l6 UTSW 15 58600311 critical splice acceptor site probably null
R4962:Fer1l6 UTSW 15 58571401 missense probably benign 0.03
R5029:Fer1l6 UTSW 15 58643920 missense probably benign 0.00
R5134:Fer1l6 UTSW 15 58640154 missense probably damaging 1.00
R5175:Fer1l6 UTSW 15 58550277 missense probably damaging 1.00
R5227:Fer1l6 UTSW 15 58581903 nonsense probably null
R5561:Fer1l6 UTSW 15 58660825 missense probably damaging 0.97
R5621:Fer1l6 UTSW 15 58558326 missense probably damaging 1.00
R5670:Fer1l6 UTSW 15 58622482 missense probably benign 0.00
R5745:Fer1l6 UTSW 15 58571389 missense probably benign 0.01
R5807:Fer1l6 UTSW 15 58590550 nonsense probably null
R5823:Fer1l6 UTSW 15 58590503 nonsense probably null
R5892:Fer1l6 UTSW 15 58564068 missense probably benign
R6006:Fer1l6 UTSW 15 58647044 missense probably damaging 1.00
R6137:Fer1l6 UTSW 15 58559206 missense probably damaging 0.97
R6195:Fer1l6 UTSW 15 58637957 missense probably damaging 1.00
R6234:Fer1l6 UTSW 15 58560639 missense probably damaging 1.00
R6237:Fer1l6 UTSW 15 58625177 nonsense probably null
R6237:Fer1l6 UTSW 15 58638006 missense probably damaging 1.00
R6271:Fer1l6 UTSW 15 58641918 missense probably benign 0.01
R6784:Fer1l6 UTSW 15 58571426 missense possibly damaging 0.63
R6852:Fer1l6 UTSW 15 58594878 missense probably damaging 1.00
R7030:Fer1l6 UTSW 15 58629378 missense probably damaging 1.00
R7088:Fer1l6 UTSW 15 58564050 missense not run
X0021:Fer1l6 UTSW 15 58569202 nonsense probably null
X0027:Fer1l6 UTSW 15 58629340 missense probably damaging 1.00
X0063:Fer1l6 UTSW 15 58618574 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGTGATGGACCCCAGTGC -3'
(R):5'- GACAAGGTTTTCTCTTAGGCAC -3'

Sequencing Primer
(F):5'- AGTGATGGACCCCAGTGCTATTC -3'
(R):5'- CTGGATTCAGAGCAAGATATAACTGC -3'
Posted On2018-04-02